Summary
Transcript IDgene_000023688
Gene IDTTHERM_01284820
Length380 bp
Sequence
TCTGCTATAGATTATTAACCAGATGTCTATTTAATTTTTTCCAAATGTTATTTATTTTTTTCTAAAAACAATCTTTAAACATCAATTTAAATTTGATTATGATCTTTTCCTAAGATTAAAAAAGTAATTAACTACAATTATTAAGAATAATAATCTTATTTGTCTTTTTTTTCTTTTTTTTCTTTAATTTATTTAACTATATTATCAACAATTTCTTTTTCTTTCAAAATAGTTTATCCCTTTTGCAAAAATTACAAATAACTTGAAAGTTTTTATTCGATTTAATTTTATTCAGTAAAATCTGTTATATCTTAAGCATTTCTATATTATTTATCAAATAAATTCCAATTTTCTTAAATTTAAACAAATTTTGAATCTTC