Summary
Transcript IDgene_000023689
Gene IDTTHERM_01284820
Length314 bp
Sequence
ATTTATTTTATTTTAAGATTATCTTTATTCTTCTTCTTTTTATATTTCCTTAAGTATTTTTTCTTCTTATTCTTAATCAATTTAGAGTTTTTTAGTATTAATATTACCCTTATTATTTTACAATAAACGTTCTTCTAATTCTTTTCTTTATTTTTCTTACTCTTCATCAAATTTTTATTCTTCTTATTTTTATTATTATATCTCCAGATCTATTTCTTATTTTATTTTGTCATCATATTCTTTTGTTTTTTATTTCAAAAATTGTATTAATTTATTAATAGAATTTTATTAATCATTAAAAAAGTAATTCAAAT