Summary
Transcript IDgene_000023690
Gene IDTTHERM_01284820
Length945 bp
Sequence
CCGGCTCTTAATCATCGATTTATTATCCAAATCTAGATCTGATTCTTTTTTATTTTTAAGATGGATTCTAATTAATTTATGATGGTTATGGTTATTAATTTTTTGTCTCTTATGCGGTAGGCGAATTCTATTTATTTTAACCTTATGATTATTGTTTATTTTCTTCTTCTTCTTTCTCTTCTGGTTTAGATGGACTATTTTTTTATGGTGATTATTAATTTGTTTCTACTTTCACTTATGCGGTAGGTGAATTCTAATTAATTTATGATGGTTATTATTATGCAGCTTATGGCTATTTTACATCATTTTTTTCTTCTTTTTATTAATTATTTTTCTATTCGTTTGAAACTTGCTAAATTGGTTATTAATCATTTTAGTTTGCATCTTTATCTTTATTATTTTAATCTGATTTTTAAATTTTTGTATCTTTTTCTTTTTTTTCATTTTTAACTCCAGATTTAACTCCAGATTTAACTCCAGATTTAACTCCAGATTTATCTTCAGATTTAACTCCAGATTTAACTCCAGATTTATCTTCAGGTTTAACTCCAGATTTAACTCCAGATTTATCTTCAGGTTTAACTCCAGATTTATCTTCAGGTTTAACTCCAGATTTATCTTCAAGTTTATCTTCAGATTTATCTTCAGGTTTAACTCCAGATTTATCTTCAGGTTTAACTCCAGATTTATCTTCAGGTTTAACTCCAGATTTAACTCCAGATTTAACTCCAGATTTAACTCCAGATTTATCTTCAGGTTTAACTCCAGATTTAACTCCAGATTTAACTCCAGATTTACCTTCAGGTTTAACTCCAGATTTATCTTCAGTTTCAGCTTTAGTTTTAACTTTATCTGAAACGTCTGGGACTGTTATGTTGATGTCTTAAAGTGAATTAACTTAACTTTTTTTTTCAGGTTCCATTTTTTAATCTCTCAATATTTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-159.9 L-258.3 L-376.9 S-041.7 S-342.7
S-638.9 S-936.6 S-1247.0 S-1536.2 S-2436.1
C-026.7 C-254.8 C-422.8 C-630.4 C-825.0
C-1058.6 C-12324.2 C-14313.7 C-16133.9 C-1828.1