Summary
Transcript IDgene_000023835
Gene IDTTHERM_00128700
Length315 bp
Sequence
CTTTTCCAGCATATGGATGAATGGAATCAGGTCTTCCAGGATGGATAAACTAGTATTCTGTAAGGTCATAAACATTTTAATCTAAAACTACCCATAAATCTTGCATCTTATTGTGTTTTTAGACTTCCTCTAAAGTAAACTCCTAATATTCAGCTTTTAAAAATCTAACTTTTCTCTTAAAGTATTCGCTTTAAGGTTTTTTTTCTATATTTCCAACTATTTTGCCTTGCTATTTCAAAATTAAAAACAAACTCTCATTGAATTACTTTACTTACTCTTCTCTATTAATCTATCCTATGTTTTTTAACAAGAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1340.1 L-2318.8 L-3178.1 S-034.4 S-351.6
S-687.5 S-988.7 S-1267.1 S-1585.2 S-2485.3
C-072.0 C-251.2 C-448.5 C-6124.9 C-864.8
C-1062.6 C-1243.7 C-1459.6 C-1647.9 C-1851.3