Summary
Transcript IDgene_000023850
Gene IDTTHERM_00128380
Length897 bp
Sequence
AAAATTTTGTCTTACATTAATTACAGTACGATTGATTACAAATTGAATATGTGATCTACATTAAAATTTAAATGAGAAAGAAATATTAGAATTATTTAATCTGTCTATTAATCCAATCAATTAGTCTTTTTTTCTTCGTGCTCTTTTAGTTTTAAAAGCTAATTTCTATGAATAGTATCCATGGCTATCATTATAAGTATTTTAATAATTGCAGCACACGATATTATATACTAAGCTCTATGATAAGTATATAGTAAATAGACTGTTGATTCAATTATTCCTATGAAATAGACATATCTGCTTAAATATCTATAGTCTTTTGTTCTTACGGCTTAATATAAGTGGAATGCAGGTATAAGCATCAATAGGAAAGATACTATATTACAACCTAAAGTGAGATCATCCAAAGTAGTTTGACGCATGTACCAAGAAGTATTAATTATTACTGTAAATTAGTAGACGATATAATCCCATTATTTAATTAGAATTAAATATAATAAAAGCTGGAAAAGAGCTATGCCTACATAAATAGGAAGAGTATATGTGTAATTCTTACCCATAATTCCATAAATCATCCAAACGCTAAAGTAAAGTCCTTTAAACAACAATTGTAAGCCGTTAAGCAATCTGCTGTCGTTATATTTTATTAATTTATAAAACCCATAAGCTGTTTCCAATATCTATAATGATGCATGAATATGATACATCAATTCCCAAGCTATGCTTTCTTACTCTGAATTCAGCACCGTTTCCATTTTACCTGTTTAATTGAATTATATTTTACTTCCAATTATTTAATTTTATTCCCTATCTATTTTCTTTTACTAAAGTTTCTAACTTTTCAGCCAAGCCAACTTGTATTATTTATTTATTTATTTTTGAGCTTTTACTAAATCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,988.4 L-22,127.8 L-32,248.8 S-0854.1 S-3825.8
S-61,230.7 S-91,124.3 S-121,222.4 S-151,360.7 S-241,356.3
C-0855.5 C-2394.7 C-4768.7 C-61,665.3 C-8858.2
C-10465.4 C-12399.3 C-14659.8 C-16698.4 C-18738.7