Summary
Transcript IDgene_000023998
Gene IDTTHERM_00765120
Length2513 bp
Sequence
AATTTATTTTTATTGAATTTTTTTAAAGAAAGGCAAGAATATAAAACATGAAATACTTTAATAGAATAATTGAGTATTTGGAAAGGCTTTGATAGGCCTTGTGATATTATAAATTGAAAATTTGTAAAGATGATATTATTTCATGTGAATAAAAATTCTTTGTCATTCTCTGTTACTTTTTTTTTTAATTTTGAAAAAAATTAATTTTGTTAATTTTTTGATACTTAGATTATTCTTATTGTTTACATTTCAAAGATTGGCTCTGTTTACTTTAAGACTAGTTTTTTAATTTTATTCAACTGTTTTACATGCTAAGCGGGAAATATGAAGATTTTGCGAAGAAATGCTTGATGAACTCATTTTTTAATTTTCTCTTTTCTTCAATCATTCCTAGATATCTCAGTTCACAAATAGCGTTATAGTAAGAAGCTAGCTGCTCATCTTCATCTAATTCAATTTTTCTTTCTCTTAAGATAGATTTGTATTCTTTAAATGACTCTGTAATTGTGAATTTTTTTCCATACTATTCTAAAATATGAATGAGATACAATCCATCAGCATTACTTTCAACTATCTCCTATTTTTTCTTTTTATTTTAACTGATATGGTTATTATACATAGGATCAATTATTTTTTTATGTATCATCAAACTGCCAAGTATATCAGGCTTACATTATGAGCTTAATTATGAAATTTCTAAAGAGAGTCGTGCAATTGCCATTATGTTAAATGTTTGATGCAAATCATAAGTTATTTACCTAACTATATTTTCTACTCTTTCCTTTTTCATTTGATTTGCTTGCTATGAAATGTCTTTTTCTGACTGAGTTTTACTAATTTATTAGGATTTTGCATACCTATCTTTTGAATGAAGATTATAACTTTTTAATTTTTATATATCATCATTTACCTATTTATTAATATCTTAAAGGTTTTGTGCATGAATTTTGAATATTTAGTTTCCTATTATATCTTCACAGAAATTTTTTAACAGCTATTAAATTGATTTGCATGAAATATTTGGATCTTTTAAAAATTCATTTTATTATGCTTCTGTCATTACATACCTTTTATCTTCATTTAAAATAATTTCTATAATTCTATGACTCTAATCAATGAGTTTTTGCGAAAAAGAGTTATCTTCATTTGATACACCATTAAAAAAATTCATACCATAAAATCTCTCTAAAAATTCAATAATTATTTATATTTCCTTTTTTTTTGTCCATAAGTCTAACTTATCAATTAATATATTGGAGCTAATCTTCTAAGATTTTCTTTATGGTTTGTTTTATCCAGCTAACTAATTTAAGGCATATTCTTTCATTTACTATAATAGTTTTATTAAATCTTCATCTTCCTGATGCTCATACACAAAATTAGAAATAGCCATTTTAACTCTCCTTACTTAATCATTATAAGTAATTGAGTACAAATCAAATTCATTTAACATATCCCTTAGTAAGTTTTTAGGAAGAGGAGGAAATTCTTCTGATTTGAGTAAAAAAAGTAAAAAATTAACAAATAAGTCTTTTTGCTTGCAAAACTCAACAGTGTATATTTGAATATCTGGAATAGAAATAAGTTAGCTTACTGGAAATAAAATGACTAATTGAATAAAATTTTAATATTGCTCATATTCTTCAAAGAAAAACTTCCCAATATCGATCATATCTTATTTGCAAATATTATAAGCTCCATCAAATACACATAATACTAAATGAGGCTAATCATATTTATTCTTCGATTTAATTTTTTAAATTATATTTTCTACCTCAAACTTAAAGTGTGTTAAAATTTTAAAAAGTTAATTGCCGCCTTAATATTTAACAATGTGTATTTCTTATGCTTAATCTTCACTCATTGTTTTTATATCACATTCTAATTATTCGTTAAATTCTAATAGTAAGTCTAAATTCGATTTATCTATCAAGAGCTAGATATAGTTTAAAAATAAAGGCAAATCCTAAATTTTACTATTAAGTATATTAAATACTTTTTATATCAAATATTTAAAGTTCTCTCTTTGTATTTCAGCCTTTTAATTGTCAATTGTGATATTATAATATTCAATTATGTCAAAAAGATGCTTAAATTTATAATTTTTATCAATAATTTGCTTTGATATATCTTTGTAATTATCCTTCAGATTTCCATATTCTTCAATTTCCATTTCTGCATTCTAATTATTTTTCTTTTTTGGTTTTTATTCTTTCTTTTCTTAGTTACAGTCCTTTTTAGTCAAACATTCAGGTATGACTACTTCAATAGTTTCTTCCCAGCCCTACTATTACTTTTTTCTTCTTCCTCTCACTCGCTTTTATTACACATTCTATTCTATATTATCATCTTCATTGTTGCTAAGAATAGCTTCTTCCCTATCTTCGTTTTCAATGTCCATTTTTTTTAAATATTTTTATATCTCAAATAATGCTAAATGTTAATATATCTTAATAGTTATATCTTTTTGGCGCAAATATTTTTAAAAGATTTATCAAAAGGTTTTTCTAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1860.8 L-2767.4 L-3801.2 S-0166.5 S-3177.8
S-6172.3 S-9163.6 S-12133.2 S-15198.7 S-24159.9
C-0217.9 C-22,622.4 C-411,412.8 C-610,913.4 C-83,244.3
C-101,224.3 C-12585.5 C-141,938.0 C-161,179.7 C-18432.0