Summary
Transcript IDgene_000024103
Gene IDTTHERM_00467500
Length1291 bp
Sequence
AAAAAAAATAAATTAAAAGCTATAATTAACTATGAACGGTTTATCTTCAAATTCTGGTCCTAGAGAAGTCATTTGTGCTCTCTTGAGAAACTTTTATACTTAAGGATGGTGCGCTGGTTCAGGTGGTGGTATATCTATTAGAAAAAGCGACGATGAAATATATGTTGCACCTTCAGGTGTATAAAAAGAATTGGTTTAACCTGAAGATATCTATGTTATTAATGTTAATGGAGATGTAGTTGAAAACCCTAAAAATCCAAAATTAAAACCTTCTGAATGCACTCCTCTTTTTAATGCAGCTTATAAGCTTCGTCGTGCTGGTGCTGTTTTACATTCTCATGCTCTTCCTGCAATGCTAGTTACCAAGCTCTTTGGAACTGAATTTTAGACAATTGATCATGAAATGATTAAAGGTATTCCTAATCACCATAATACAGAATGGTGTGTCGTCCCTATCATTGAAAACACTGAAAAGGAATGCGAATTAACAGAACGTTTAACTAATGCAATCAACGCTTATCCTCGTTCTAATGCTGTCTTAGTTCGTAATCACGGTGTTTATATTTGGGGAGAAAATTGGGAAAAAGCAAAAATACATGCTGAGTGTTACCATTATTTATTCGAAGCAGTTGTTGAAATGAAGAAATTAGGTTTAGAAATTCCACGCACTGTTTCAAGCAGTAGCCAATTACGTGCTTGGTATATTGATGAAAATGCAATTGGCCAAGATGGTGATATTCGTGAGAGCTTACACTATCGCTCATATAAGTGGGTTAATCCAGAATATTTGGCAACAATTGGTGTTGAACACTGGAAATTAGACGGAGAAGAGAATAATACTGAACTTGAAAGAGTTTGCAAATAAAGAAATTACTCTTCTCGTGATTAAATTAAATGTGGAAATCATTGTGAAAATTACTAACAAATGTTATCAAATTTCAGAAAAGAACACATCCATTTAGATGAAGAGATTCGCTATATTATAGGTGGTAGTGGTTATTTTGATGTCCGTGACCATGAAGATAAATGGATTCGTATCCAAAGTGTTAAAGGTGATTTAATTGTACTTCCTGAAGGTATATATCACCGCTTTACAACTGATAAAAATGATGGAGTTCATGCTATGAGATTATTTAAGGATGAACCTAAATGGACACCTTATAATCGTCCTTGTGATGAATTGGAAAGCCGTAACAAATATGTAGATTAATTCTTAAAAAAGTTTTAAAAATGATATCTTGACTAGTTTATATATCAAATCTTATATGTTAATATGAATTCAATAGTTGAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,359.2 L-23,328.5 L-33,109.8 S-0730.6 S-3663.1
S-6622.5 S-9711.9 S-12731.5 S-15848.4 S-24804.7
C-02,077.7 C-2149.0 C-4214.9 C-6133.5 C-8376.3
C-10310.1 C-12270.0 C-14469.6 C-16441.9 C-18456.4