Summary
Transcript IDgene_000024123
Gene IDTTHERM_00467770
Length1054 bp
Sequence
AAAATAATTAATTTTTTTAGACTAGTAACCAAGATAGTAATAAAAAATAAATATATTTATACTGGAAGATACACAATATTTTGAATAATAATTAATAATTTCAATATATTTTAGTAATTAAACACTGAAAGAAAAATAAACTACTATTCTATAGTGTAAATCATGGTTCTACCCAATCAAATCTAACAACTTAATCTATTGAGAATACAGCATCACAATCAACTTTATCAGTATCTTCCATAAATCCAGGACAAGTATACTCTCCTGTAGATTTGTTGAATCTTAGTTTACCCCCTCCACATTTAGTGCATTGTGGTATAGCACCAAGGGTGTATCCATCTGCTACTTTTTCTAAAAGTACTTCTTTAGTACCTGTTTATGTTTAATTATTTGCTTTTAAAATAGCTTTGAGTTAAGCAACAGTTTTAGATTTTAGTTCTTCTAATTTTTTTAAGTATTTTTATCTTTAACCATCTGTGTATCCAGCCAAGCTAACTTCAGCATCTATATCTTCATCGCTATCATCAGCTTTTGATCTCTTGTTGGTTTTCTTTTCAGACTTATTCACTTTTGTAGCTTTCTTTGCTTTTTTAACTACCTCTTCTCCTGAATCAGAATCTGAGTTATCTGGATCCCAGTTTTTATCTTATTTTTTACTTTTTTTATCATAGTTGTTTCTGTATTTAACATATTCATCCACAGCATTGTTAAATAAATCCTTTTCTGTTTACTTAGATGGATTTACATTCATGTTTTTAAGCTTTCCTGTTTATGTTTTAGGGTTATAATCAACGATAGGATGACCAGCTACAGGAGGTAAACACTTTTGGTGATAATATCTTTTACTTACATAAATAGGTTCAGCTCTATCTCTTTCTGAGCTACACCATCTGAGCACATCTTTATCAATAGTTTTGCCACAAGATCTGCACTTGGCTTTATTTGAAACAGAAACTTCGAGATATAAATCTTCGTAGAATTTATATTCTGGTGTATTGCTATCATAATCATAAAAATTCATTTGAAGTATCCTTTTTGTAAATATTTATTTTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,025.3 L-2897.7 L-3727.6 S-01,168.6 S-3891.5
S-6727.9 S-91,049.3 S-12803.6 S-15756.1 S-24558.2
C-0295.7 C-21,084.9 C-4993.8 C-6459.2 C-8235.2
C-10377.6 C-12340.7 C-141,033.5 C-161,033.6 C-18514.5