Summary
Transcript IDgene_000024261
Gene IDTTHERM_00753570
Length529 bp
Sequence
TTTTTAAAAATAAATTTGTATTAATCTTACAAAATAAATAAATACCTAATAATACATCAATTACATTAATGATAATTAAAATTATTTAAATTTATTATTTCAATGTTGTACAAACAAAACTGAAACTATGACAGCCAAGAGAATGAAAGCGAATGAAATAATTCCAGAGCTCAAACAAATGTCAAGTTAACTTCCATATTATTAGATACTAACGATTGTGCTATTTTTAGCGATGGGTAAACATGATTGATCAAAACAAATTTTCACTCCACCCATAGTTTATGATTTTAAATCTCCAATACAACTTTTTAAGCAAGTATCAATATCAATCTTTGAATTTCTGCAAGGAACAATATTCTCGGAAGTGCAAGTGACTTTTATGTTATCTGTGCAATTATTAAACTAGTTTATTTAATCTTGACTTATGTAGGCATTAACAGTATTAATAGCAACAAAAGCAAGAAACAATAAGGCAAATTATTTCATTTATTTTAATTAATTAATTTAGTTAATTTATTTTTGTTTTGTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-160.1 L-2156.1 L-32,893.6 S-042.0 S-350.0
S-6108.5 S-9114.1 S-1290.1 S-15117.7 S-2459.9
C-0166.4 C-252.6 C-472.5 C-644.6 C-862.6
C-1083.7 C-12237.4 C-14632.4 C-16814.1 C-181,768.3