Summary
Transcript IDgene_000024262
Gene IDTTHERM_00753580
Length539 bp
Sequence
GTTTGAAATAAAAAATAAATTTGTATTATTAATCTTACAAAATAAATAAATACCTAATAATACATCAATTACATTAATGATAATTAAAATTATTTCAATTTATTATTTCAATGTTGTACAAACAAAACTGAAACTATGACAGCCAAGAGAATGAAAGCGAATGAGATAATTCCAGAGCTCAAACAATAGCCAAGTTAACTTGCATAGGTTCTGACAGTACTCTACGTGCTATTTTTAGCATAGGGTATACATTAATCTTAATAACAATTATTTACATCACCCATAGATAGAGTATTCCAATTTCCATCAAAACAATAATCTAAGCAATCTTCAACTTTAGCCTTTTATTTTAAGCAATCAGTGTTGCTTCTATCGCAAGGAAGTTGTATTTTTTCTGTGCAATTATTAAACTAGTATATTTAATCTTTACTTATGTAGGCATTAACAGTAGTAATAGCAACAAAAGCAAGAAACAATAAGGCAAATTATTTCATTTATTTTAATTAATTAATTTAGTTAATTTATTTTTGTTTTGTATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-144.2 L-2112.2 L-33,511.6 S-041.9 S-386.3
S-6387.5 S-9450.7 S-12544.1 S-15464.9 S-24155.4
C-0354.6 C-2348.5 C-4179.7 C-6132.3 C-897.2
C-10209.5 C-121,835.2 C-143,823.3 C-164,081.3 C-185,394.8