Summary
Transcript IDgene_000024409
Gene IDTTHERM_00456860
Length5280 bp
Sequence
GGTTTAAAATATTTATTTGAAATTTATGACTGCTTTAGGAATGACTCAATAAGTAAGTGAGTGTGTTTGTGAGTAAGTAAGTAAGTGAATGAATGAATAACTGAGTTTCTTTAACTATTCCTAATTTTAGTTTCATTTTTATATGGTGGTTTTATTGTATCTCATTTATTTTTTGATTTGTAAATTTTAGTAAAAATATTTATGAGCTGGCTAACTTGTAAGAATTATTTTTCAATTCTTTTATTTAGACTCCTCTTTACTTGAATAGCTTTCTCTTCTCTTTAATTCTTCTTTAGTTCCTTCGGAGCTACTTTATTATTCTTTTTTTTTATTTTCTTCTTTTTCTTTTGTTTAAGATGTTTCACTTTCTTTTCTTTTAGAAGATTCATCTTTAGAATGATCTTTGTCTTTATATCTATCTTTTCTTTCACTATCTTTATGATCATAATAATATTTGTCCTTGTCTCTATATCTATCTTTTTCTTTATAGTCACGATCTCTTTCTCTATCATCTCTATAGTCTCTTTCTTTTTCTTTAGGATCTCTGTCTTTATCACGATCCTTATAATCTCTTTCTTTTCTATAATCCCTACTATCTCTATCATAATGGTCTCTATCATAGTAATCTCTCCTATCTCTTTTCTCTCTATCTCTATCCCTCTCTCTGTCTCTATCCTTATCCTTTTCTTTATCTTTATCTTTGTACTCTCTCTCCCTATCTTTTTCTTTATATTCTCTATCTTTGTGGTCTCGATCACTATTATCACGGTCACTCTTTTTATCTCTCTTATCTCTATCGTCACGATCATGTTCATACTTTTTATCTCTATGATCTCTATCGTCACGATCAGAGGTTTTCTTCCTATCTCTATATCTATCACTATCCCTATCTTTAGCCCTATCTTCTTTATCTCTATAGTAATCTCTATCTCTCTCCCTATCTTTATCTTTATTATCCTTGTGATCATGGCTTGTTTCTTTACTACTTCTATCTTTTTTTTAAGAGTTACCATTATTTTTAGTATCATCTGCTTTTATGTTACTGCTTGAAGTTTCTTGGCTCTGTTCACTATTGACTTATGGTTTTTCAGTTTTAGATGATTACCTTTCTAATACTAAATTATTTAATCCAGTTTCTACTGTTTGTTTGCTTGCAGTAACATTAGAAGAAGATGTCACTCCATTTACATTGCTTTGACTATTCGATAATTTGCTTTAAGAATTTTTTTCTAGGGAATTTGAATCATCACTTCCAGCAGGTATAACGCTTTAAGAATTCTAAACAGTACTTTCAGCAGGAGTAACTTTCTTATCTATATTACTAGGTTCGTGTGTAATCAAGCTTGTGAGAGAAAAAGAAGTATATCCTTCTATTTCCATTTCATCATCATCGTCATTATTATTTTTTTTAGTTTCTGATTCTTTTTGTTCTTTCAATTTATCACTTTAGCTTTAAGAAGTAGTTTATTGTTTTGTTTATGATCCACTACTTTAACTTTTTATTGTAGACTATGAGTTGTTTTGCTATTTTTATGAATCAGATGATTTATTTTGTTATTAATACTAATATGTGTTCGAGGAGGTTTTTTGCTAGCTATTAGAGTTCGAGCTACTAGTAGAATAGACTTTTGAATTTGTTTTTAATGTAGTTGAAGATCCTGAACTTGGTTATTCTTAAGACAAATTATCTTTTGAAGTAGAATGAGAGCTGTGGGCTGAACTTTCTCGGTTCATATTTGTACTTTGTTAAGACTAATTATCTTTTTATTCTTTTTATCCTATTGGATTATTAGATGATCCACTGTCTTTAGTTTATTAGGATTATGAATAATTTTTTTCACCTTAATTTGTAGAGGATGTAGATAAACTAAAATTGTTTACATGTGTTTATGAGCTCTCTTTTTTTTGTTAGCTATTAGAAGAAACAGTTTTAGTTGGTGTAGATGATTAAGGTATCTTAGTAGGAGTAGACGCTTGTTTAGTAGGAGTAGTTGAAGCAGTTAATCTATATTGGTTACTGTGAGTAGCTTTAGTTGGAGTTGCAGGAGTAGATCTCTGAGAATTGGAAGCTCCTACTCCAGGTTGGATTTAGGTTCCATTAGGGTTTACTTACTTTTATGCTAAAATTGGTTATTTTTAACCTTAATTAATTGTGCCAGGTTATTATGGCTAAGGTCTTTAAGTGTTTTGTGTCTAAACTGGTTTTACCTATTAGCTTTAACTTTAATTTTATGGATTCTATTATTTTATTGCTTAATTCTACTATTATTATGGCGTTTTTTAAACATTTGTATTACTAGCTGTACCATTATTAACTGGTTTACTAGCATTCACTTACCCAGCAGGATTAGCAGGATTTGGCTTACTGATATTAGTTGCTGAAGATTAGCCTGGTTTATTTAAATTAGTGTTTTATCCTGGAGTTTGAGGCTTAAGTGCTTAAGGGTTTGATTGTGTATTTTGTATTTTGACAGCAGCTTAAGGATTTGCTTGAGTTTTTTAACCTTGTCCTGTTCCTATTGCAGGATTCACTTATGTTTTAACAGGATTTTAAGTATTACCTTGAGCTTACTAAGAGTTAACAGGTTTTGCTTAGTTAGGATTTACACTATTTTAAGGCTTAATATTACTTGAATTTTAATTTTAAACAGCAACTTTATTTTATGTTGTATTTGTTCCACTTGAAACAGAATTTTAACTAGCTGATCGATTTTATTAATTTTATTGAATTCCTTATGAATTTTGAACAGGTTTTTGGTTAGTGCCTTGTTAATTTTATACTTAAGTAGTATTCTTAGGGGTTGTATTAGGTGTTGATCCTGCTGGTGTCCCAGCTGTTGTGTTATTTGCTGGCTTATTTTAGACTACGCCAGTCTGATTTTATGTTTAAGGTTTATTTTAATTTTGTTGAGAAGGATTTGCAGGTTTTATTTAAGAAGAATTTGATATAGCACTCCCATTACTACTTTAGCCATTAGTCTAATTTAAAGGTTTGGTTTAACTATTTTATGTTACAGCAGATGTATTTGGTTTATTTTAATTCAAAACATTTGAGGTATTTGAATTAGTAGTAGCAGCAGGATTATTAATCTTATTTTGTTGCTAATTCTATGTTGTTTATGGGTTAGCGCTTTAAGGTTTAGTGTTAGGTGCAGAATTAGCCTACTAGTTCGCTGGATTTTATGGTTTTTATACATTTTATTAAGATTATTAAGGCTTAATTTAAGCTGAACCTTGATTAGAAGGAGTAGAATTTACTTTTGGGGGGACACTCTTTTATATATTTTATAAAGCAGCAGTTTATGCAGAATTATTTTATGAAGGTTAAGTTGATACAGTTTATTGATTCAAAGGCTCTTCAATCTCCATAGAATTTGAATTATTCTATTATTCTTCTTTCTGGGTTGAGTTATTTTATTAACTATCTTTACTTTACTCAGGTTTAACATTTTATACTTGAGGATTAATGTTATCTTGCTTAGCTATCTTCATAGGTTAAATAGGTTTTTACTGATTTTTTTAGCTTTTATCATCCTTTAAATTATTAGAATTTGCTTTGTCTTGTGAATTATTGCTTTGTTCTTCATGATTCTTTTATGAACTCCCGTTTTATTTTACTTAACCCTAATTTTCATTTTCTATTTCCATTTCATTATTTGTAGAGCTATTAACAATATTTTATTATGATTACTCAGAGTTTTCAGATTACATTGAAGAAGTATCATTATTCAATTAAGAAGAGACTTTATTATTAGGGAGTGAAGTTTTTTATAATGGATCTTTATTATTAGGTTAGGATACAACAGTATTTACTTTTTAAAGGATAATTTTATTAGAATTTTAAATTGCTACATTTTAATTATTGCTCGAACTTATGTTAGATGTTTAAGCACTTTCGTTTATATTAATTGGTTTAACTTCAGGTTATTAATTATTTTGAAGAGGTTCTACTTATTTTTATTGCTATTATTTATTGTCTGTACCTTATGTACTTTAATTAATTTGGTTATTTTCTATCTACATTTAAGTTACTTCTTTTGGCTAAACAGAATTATTTGAAATATTTGGCTAACTATTTTGTACCTAATTGATATTTTTGCTCTTTTAGAATGGTGCCGCTCCTATAATATTTAGATTGGATCCTCCATTAGTATTGTTGGGATTGTTTGGTTGTAAGTTTCCTATTACATTGTTTTTATTAGAGCTGTTAGTTGAAGATGCCCTCACTTCTGGTTTTTTAAAAGTTTAGTTTTATTTTGCATTGTTAAAAGCAGAAAAGTATTTCAACTAAACCTCCTTTAAATCAAAGAGTTTTGCATTTTTAATTTTTTAACTCACCTTTGTAATGAGTGCTTCATTTTCTTTAATGAGCTATTAAACTTCATTTGGAAGAATTTATTCAATGCACTTATTTTTTCCTTGTAAAATAATTAAAACGCAACAAAGTCCTAGTATAGCTTAATCGTATAAGAATATAGTATCGTAATCCAAAAACACATTTATAGAAAGCTTAATAGTTTCTTGTTGTATTTATATGAACTCTTTTTAATTGGATTTTAATTGTTCTTAAACATAATGCATAAGACTCTCTATTACACGATAAATAGACTCAGTCTGAATATTAAAATATAAATGTTCAAGAAACTCTTTTTCAATTTCAGGATAATGTTAATCTCCAATAAACTTACATTTATCCATTCCCTGCTTTAATTTTAATGTCTTAATTTTCTCTAGAGTTCTATCCTAAATGTGTAAATTTTAAATCTTCAAGGCTACAAAATAACTTGTCATACAAACTTATTCTATATTTTAGCAAGTAACTGGACTCCATCTAAGAAAATATCTTTTTACAAGGTGCATGGTATCGCTTAAAATTTTTAGATGGGAATATATTTTATCTTCTCCAAAATATTTAATTTTATCGATGTAATGATGCAGCCATGTTAAATATCTTTAAACTATGATAGATTCTTCGTGCAAAGTGTATTTAACTTACTATCCATCTATGGTTAAATAAAAGTCTGCTACTTATTCCATTCTTTCTTCATTAATTTTTTGAAATGTCTACTCATCAAAAAGCATCAATCTAACATTTTAGACCGTTATTTAATCCATTTCAAATTTTCAATTGCAAATTTCCTAACTATATAATATTAGAAAGCCTATTTGGAATTTCTTTGTTTCTTTTTTCTCGTTAAAAGTAGCTGAAAATTATTTTAAACTCTATCAATTTAAAAAAAGTTCAAAGAATTAAAAATCTTTTGATAATTTTTTATTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,650.5 L-21,579.7 L-31,151.7 S-01,659.9 S-31,500.9
S-61,073.9 S-91,332.7 S-121,390.5 S-151,349.4 S-242,104.4
C-02,437.9 C-214,375.7 C-47,650.2 C-610,853.1 C-88,533.3
C-102,809.2 C-122,391.9 C-141,349.3 C-162,070.7 C-182,223.5