Summary
Transcript IDgene_000024410
Gene IDTTHERM_00456890
Length1489 bp
Sequence
GTTATTATTATTATTTTTGTTGTTGTTGCTGCTATTAATTAGATTTAAACCAAATTATGTATGTTTAAGAAATGGAGAATTAGACTGTACTGTACTGTTTGTTGCTGCTTGAGGATTTTTATAAATAGAAACTTGAAAGTATGAGTAATCCTTAACTTGGCTTTACTTATTCATTGCATTTATCAAGTTTTATTGATTGATTTATTGCAATAACAAAATGAATGAGTCTAAGATTTTATATACTTGATAAGATTTATTTATTTAATAATTAATTAGTTATGATTTAAATATAATTTAAAATTATTCTAAATTGGTTATATGTGTGTGTGATTTTAATTTCTTGGTTTTGATTTATTCATTTTAAATTAATTAATGTGATTAAATACTTTTTTTTCAGTTTATTAAATTAATGTCAAACAAGTGGTTACTATTGTAACATTTATTCTAACTTAATTATTTCTTTTTTGATATCTTTGTACTCCTTGTATTCATTTTCAACAGGTAAAATGTCTCTGTGGTATTTTATCTTTCTGTTGTGGGTGCGATAAAAATCGTCTTAATAAACCTGAAGTTGCTCTCTTAGTTAAACTCTCTTTCTCTTCATCAAATTAATTTTTTGTTCTATCAATTTTTATTATTCTTTTATTGTGGCATTATTACTATTATTGATTTGATTGTTGATTCCATTAAGCTATTAGAGAGATTATTAAGAGCCAAGATGCTGAATGAGACCGTTATTAAAATTCTCTTTCTGCTCCTATACTATATTCATTATGTCTTTATAAGAATTTTTGTCAATTATATCTTTGTTGCTTTTACGAACGTCTCTGTTTTGACTGATGCCAACTCTCTACTATTAATTTGAAGCTTAAAGAATCTTAGAATTAACACCATTATTACCGGCATTGAGGCTAGTATTTAAGCTGTTTACATTTTGCTTATGATTTGGATTATGGATGTCAAAGGAATCGTTATGGCTTGTTTAATGACTGTTGATTCCTAGTTAGATAGACGTTTGGGCTGATGAAGGAACTGAAGAAGAGATTACATTCTAGTTATTAAGTTACTTTAAACCTTAATTGATAGATGTATTTTATTATTATGAAATGTGGATTGATGAGGTCTTATTTTCATTTTAGCCTTTAGATAAAGCCTACTTAAGTCCTTTGTAATATACATACAGAGGTCTCATAGGCTCTTTTTAATTACGAGTAGGTTAAACATTGAAATAGTTTTCAAATGCTTAGTCATACAGCTTTAATTCATTTTTTACTCTCTTTTTTTCTGTTTATAGCTATTCGTAGCTCATTTCTTTGATAAGTCTTTGAGTAATTCTTTAATTGTCTAATCCCAATCTCTTCATGGACTCTTCTAATTTCTTAGGAGCTTCAATTCTTATCCATTCCTCTTCTGGAGTAAGTTGACTATTCTCACCGATTTGATTTTTATTTTAGTTAGTGAAATTATTAATTAAAATACCATTTTATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,211.9 L-22,239.8 L-31,694.7 S-0865.6 S-31,563.3
S-61,285.3 S-91,741.5 S-122,412.0 S-151,709.3 S-241,792.9
C-0443.1 C-21,434.6 C-41,185.4 C-61,232.5 C-83,650.7
C-102,684.7 C-123,701.6 C-143,710.2 C-161,802.5 C-182,231.7