Summary
Transcript IDgene_000024596
Gene IDTTHERM_00497330
Length340 bp
Sequence
ATAAAATTAAAAATCAAATTCATAAATAAAAATAGCAAGAACTATCAAAAAAGTAAATTTAGAAAAAATGTTATATCACGTCAACTCCCCCTACTACAGATAATTCCTCGTCATGACTGGTTCCAAGAGAGCTCAAAAGCAAGTTCAAGGCCAAAATGAAACCACTTCTACTGAAAACAGAGGCAACGTTAACCCCTCTTCAGTTGGTGTTTGATAAAATTGAATATAATAATAATAATAAATTATTTAAACACTTAAATTAGTAATATATATCATATGCTTTTGTAAACAATTATTTTTTGCGTTTATTAAAAATATTTCATATTTAAATATCTCTCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-122,963.5 L-216,882.1 L-314,492.4 S-05,854.0 S-38,544.1
S-68,814.8 S-96,881.5 S-128,339.8 S-158,779.1 S-247,287.5
C-08,019.3 C-26,987.5 C-43,768.1 C-62,599.5 C-82,576.3
C-103,819.6 C-124,113.9 C-144,292.3 C-165,527.4 C-185,849.3