Summary
Transcript IDgene_000024640
Gene IDTTHERM_00498100
Length1328 bp
Sequence
ACGTATTTTATTCAATAAGAAATTTTTTGAAAACAGCACATTTTATTTGTAAAATAAAATGGAAATTGAACAATTAGAAGAAGAAAAAACACAATAAAACTTAAGTGATTCTCAAATTTAATCTTAGAAAAATGATAATACCCAAGTTAGTATAATTAAAAAAAGAAAAAGAACAAAAGCTTTCAAATTTTGTAAATTCTACTATTAGCCACAGGATATTGATGATGAACCAGTTTATATATTTTTTTTAAATAAAATTTACAAGAATTATGAATAAGAATAATACAATTAATATAGAAACTATGGATTTACTGATGCCGGCATTGCGAAAATAGAATATGTCTAGTTAGACAAAATCTTTTAAACTATTGATTTAAAGTTTGATTTTGTTTCTTTAGGTGTAGATAACTTTAGAAAACTTATATAAATTTTTAGAAAGAAAGCAGATAGAGATTATTTTGAGCTTTCAAATGCTCTTAAAGAGTACTAATTATGGATAAACTAAATTTTTAAAACTGCAGCAGAGTTATTCTCTGATAAGTAAATATACAATTAAAGCCATCAAGAAGAAGTTGATTAAGCCTTCCCAGATTTTGAAAGGATAGTAAAAGAATGGGCTAAGGAATAACTTCCTAATGAATTATATGAGATAGAGCTATGCTCGATTAAATATGATATGGTTAGGCCAATTCTAAAAAAAAAGATATATTCAAAAAACTTAATTTTATTTTTAGGGAGTGATCTTGAAGATATTTATTAAAAACTTATTGATTTTAACTTAAAGAGTTACATCCATAGTCTATTAAATGGAGGTGAAAATAATGGCAAATTATAATTGTAAAAGGCTATAAAAATAATAAAATGGATGACTCAATACTAAAAGGAGGAGCTCTTCTTTGACGACGAAATTACCACTTTAGATGGCTTGTCTATCCCAACATAGAAATCATTAGCTTACTATTCTTACAACTATAAATCAAAAACTATTTCTTAAAAACGTGATTAGCATTTCTTTTATGTTACTAAATATAATTTTGAGCCTCACTGGATTAATTACCTAATTTAGATGAGATAAAAACTATAATAAATGCCAAAGCAAATAGGATGCAACTAAGTTTATTAAATCTAAGGACAAACATTGAATTAAGTAGATAAAAACTTTGAGTTTATTTGTCAGCAAGAATATTTTTTAGAGAAATTTAACTATATATAAAAAAGTTTAAATTGACTTTTTTGTCAATATCCTAATTATAATTTAAAAAACTGTTTAATTTTATAGCTATGTTAGTGAAATATTAATTATTTTTCTTCAAAAATTATTTTTTATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1107.7 L-2212.0 L-3227.8 S-0412.0 S-3265.8
S-6259.8 S-9273.7 S-12160.2 S-15162.7 S-24152.4
C-0429.5 C-21,413.3 C-4581.2 C-61,337.5 C-8820.4
C-10220.9 C-12202.9 C-14228.8 C-16307.4 C-18218.3