Summary
Transcript IDgene_000024908
Gene IDTTHERM_00865250
Length572 bp
Sequence
TTTTGAATAAACAATTAAACTGTTTAAGGATGATGCAACTAATTATAAAAATATGAATTTTAAAGTATTTATATTATTAATTATTATGTTCTTTTATCAATCAGATTCATATTATTTTTATTTGTTTATTTTATCACATTTTACTTTTAAATCAATCTAATCTTAAAATAATGTGAACACCAGAGTCTGACTCAACTAAGTTAGAAATCTCTCCGACTTTAAGAGCATATGCAGCCTATTCAAATGATTCTTGCATTTAACCAGGACCAAACTCTCCCAAGTCACCTCCATTTCTAGCAGATGTGCATTCAGAATACTTTTGTGCAATTTCCATAAAAGTTTTTTAAGGATCAGCTGATTTCATGATCTATTCACGGAAAGCTGCTACATTTTTTTTAGCTTCATCTAAAGTTCTAGTAACTTGGACATTTCTAACTCTATCAAGTGGATTACGACTTCCTCTATGCTTTTATAAAATATGAGCAGCTCTGATTGTTTAAGAGTTCATTTATGATTATTTGCTTTTTTTTAATATTAAATTTAGTGATTTTTAAGAGATTATTTATTTTTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-17,196.2 L-27,085.8 L-36,503.5 S-09,651.4 S-37,398.8
S-66,034.1 S-95,305.0 S-124,815.9 S-155,233.5 S-243,608.9
C-01,610.1 C-22,182.8 C-41,580.9 C-61,100.5 C-82,184.6
C-102,165.0 C-124,623.0 C-142,959.6 C-163,217.4 C-182,389.6