Summary
Transcript IDgene_000024967
Gene IDTTHERM_00314870
Length576 bp
Sequence
TGCATTATCAAGATACTTGGATTTTTCTACTAGAATACCCAAATCGCCTTGTGCTTCAAGCAACTTTTATATATCTTCATGAAGTATAACTTATATTTCATTTACTTTATTCAGGACTTTAGTTAACTAATCTACGTTAGCAGGATCTGAATAATCTTTGAGAATTTACTATATGGCAAGTATTTTTATCTTTTCATCTGATTTTATTCCTTAGTAACCAATTGCTAGCTAAGAAAAAAATCCATCAAGAACTTTTTCTAAGCCTTTGTATATGACTCTTCTAGGATATTCTCCTTATGTGAATGCGTATGCAACAACATCATGAGTTAAAGAAGAGAGAATATAAATATGATAATCTTCATGTCTTACTTCGTGCCTTGTACCCTTTTGAATGCCCACAAAAGATTCACTAACAATGAATTTAAATAAATTTCTAACTTTTCCTCTTTAAAAAACACTAATTGAACTATCTTCATATTCTCTAATTGGTATATATACCTACTTATCAGTAGAATTTTTGCAAGCACATAATATTGCTATAAGCTTCATTTACTATTTTATATTCAAGAACTTTAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1220.6 L-2315.0 L-3330.6 S-01,020.9 S-3621.7
S-6746.8 S-9710.3 S-12367.6 S-15499.0 S-24438.8
C-067.3 C-2442.8 C-4233.4 C-659.2 C-843.8
C-1042.7 C-1246.5 C-1470.0 C-16107.2 C-18136.2