Summary
Transcript IDgene_000024973
Gene IDTTHERM_00316040
Length577 bp
Sequence
AATTTAATTAGTGGAAATAAGTCTATTATAACATAAAGAAGATGAGTTCACAAGATAGTAGAATAAGTGACGAAGAGTTCGAAAGAAGATTAAATGCAAAAAGCTATAATACTACTTATAGAGCTCCTGATGAGCAAAATGTATAAAAGGATAAATATATCGATGATTGGTTTAAAAGCTAGAGATAATAAAGTGGATAGACTCTTTTAAATGAAATAAAAGAATTTGAAGAATAGAAATAATTGTAGAATTTTACTTAGCAATAAACGGGAGCAACTTAAGCACTACCTCCTAATGCTATCAACAGCTAGCAAAGCAAATTCTTTAATGAAACTAAAATTTTATTCCCAAAAGAATTGAAATTTGAAAACTTTTTAAATGATAAATATGCATCGTTTTATTACTTCTCACATCACCCAAAAACTAGCAATAAATTCGAAATCAGCGACATAGATACCTCTGATAGATTACTCAAATCTAGAAATACTGGATATCTCACTACATGGCTTTCAATATCACTAGTTTCCTACTATATGACAAAATATCTCAAACACTCCAATATTCCTTGGGGAATTAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,529.3 L-21,959.0 L-31,554.0 S-0262.6 S-363.6
S-6110.3 S-9103.3 S-1293.8 S-15170.7 S-24172.7
C-059.7 C-2351.5 C-475.0 C-649.2 C-8147.0
C-10433.3 C-12237.7 C-1486.0 C-1673.9 C-1895.3