Summary
Transcript IDgene_000025026
Gene IDTTHERM_00317410
Length765 bp
Sequence
AAGAAATAAAGAAAGCTGATGGAATTCAATCAAACTTACTTTACTATTTAAGGAATATTTTACACTATTAGCATTTAAACACTAAATATATTAAATTTCAGCCTCCTATTCGAAGGGCACCACCTTTTCTTTGCGTACTATGTTAGCTTATTCATAATAGAGAAACTTTATATGCATAAAAAGCTATCTTAAAACAGAGATGAAGAAATCTTTCTCTTTTTTGACATACTTGATCTCTATTTTCTCCTCAAAAAAAAATCAGAATAAATTTGGTCAAATGATATCCATTTTATGATTAAATTATTTATTAGATTTTTCTTTCTACCCTGGGTCTTCTATATTTACCTACTAAGAAGCGAATACTTTTCCTACTAAAAGCCCTATTTGCAATATTTGATAATAATATCATTTATTTTTATTATTATTTAATCTGCTAATGTAATGTACTTAAGTAACACATTTAAAGTCCACTTTCTGAATATGTTTGAGTTCTTAGCGTTTTTATCAGTGCTAATGCAATGTCTCTCTTTAACAGGTATGATGACCCTCTTTATAATATCCTATTCTAACTTTGAATTTTGGATAGTAGTGGCAATTAAATTGGCCATAATTGTTGTTTTCTGTCTTGCGATATATGGTGATAAATTTGAATTCTACAACGTAAGTGATAATCAAACTAAGACGTTTCTTTCTACTCTTTTAATATCTTTTTCATTCATTTCTGATACAAGCCCATTTTTTTCTTATGGCAAAATAAAGAAACCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1475.0 L-2412.6 L-3390.8 S-0374.8 S-3451.6
S-6506.2 S-9402.4 S-12380.2 S-15472.9 S-24641.7
C-0868.1 C-2573.6 C-4620.1 C-6599.1 C-8279.1
C-10501.3 C-12394.1 C-14383.8 C-16336.3 C-18347.7