Summary
Transcript IDgene_000025029
Gene IDTTHERM_00318530
Length1213 bp
Sequence
ATCTTTTACCAGGAGTTCGAGGAGTTAGAGTGATCGTTTACATATGTTGAGTAGAATTTGTTTCTTTTCTGTTAAGATCTGAATTCATAATTTCTTTTAAAATATTTTTGTTTATTTACTATTAATCAGTTATTAGGAGTGATTTTCTGTGCTAGGTAATAATTTTTTCAGTTTCTAAAATTTCTACTTCCCATAGAGCAGTATCACTCTAATTAAACTCTCTTATTTTTTTGATAAAAATCATAATTCTAATTATTCCTTTGGATAACTTTATTGTTATGCATGCTATACTAATAATTAGTGCCACAATCAAAGAATAATCAAGATAAAAAGAGGAGGTATTAAATTGCTTCTATTGATTATCATTCATCAATTATGTCAATGTTAGCTATCCTACTTACTAAAAAAGGATAACTACAGTTGAGAGACCTGCATAATAAATAAATTCAAGGTAATTTTCCCAATAATGCTTAAAAGGTTTTTAGATTAAGGCGAAAAACCCAAGTGCGAAATATCCAAGAATTATAATTATAGTTTGCTATTTAAAATCTGTCGATTAAACTACATAATAAGCACAAATCAATATATCAATAGAAAATTGTAAAAAGAAGAAGTTTGCAGAGTTCGGGTTTAGGTCATATTCAAAAAATTTTTTTAACTTGTTCTCCTCATTTTTATTAATTAAATATAAAAATACTATGCAAGATATGTAAGCTATTCCATAAATAATTAAGGCAATCAAAGATATAGCTGAACCTGGATATGAAAAACTCTAAGTTGTCAATATATCTACCAAGCTGAAGAAAAATATCTTTATCATTAAAACCTGCAAAAGAGTCATAAATAATGGAAAAATGATATTATGATCAATCTAATATATTTAATATCTCCACTTTTGCTTTCGATAAATTTTAGATGAGATCAAAACAGATTTTCTCAAAACCGTTAATTTTAATATCAAATATATGAAGAGGACCAATATAAATAAAAAAAAGTATCCCTGCCCATTTTATAAAAAGCTTGTAGGTTTATTTTGTAAGAAAATTCTTTTATTCAGTAGATTCCTTTTATTAACTTCTTCATAGCTTGGGCTAATGAAGTTCATAAAATTAAAGATAGAAAAAGGATCTTCAATTTCTTGCAACTCTGTGACATTTTGTATTATTTTGCTTACTTTAACACTACAAAAGTTCAGATAAATTAACATGAGATT