Summary
Transcript IDgene_000025030
Gene IDTTHERM_00318530
Length341 bp
Sequence
AGACAAGTAATACAGTTATGAGCTTCAAATCCATCACATGTAGCACAAGAAAAATGACATAAAGAGCAGCTCATTAAATTTGAAATAAACTAATTGCTTGAACTGCTAGAGCATTCACACTTTGATATAATAGAAGATTAAAGTGTTCCAGAAAAGCATTTTAAGCACTGAGATTTATTTGCAGAACAATCTTCACAAAAAGCAACATCACACTATTAGCAAACACCTTGATTTTGATAATATCCTTTTAAGCAAGAGCATGTTGTTTTATCTTATGAAATTTACATGTTTAAACCACATTATAAACATTAACTTTAATTTTAGCATAAAATGCAACCTAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-137.4 L-244.4 L-328.0 S-041.7 S-362.6
S-640.7 S-948.7 S-1263.7 S-1527.2 S-2425.1
C-044.5 C-2128.4 C-4168.6 C-6281.8 C-8200.7
C-1087.4 C-1248.8 C-1435.4 C-1674.6 C-1862.2