Summary
Transcript IDgene_000025031
Gene IDTTHERM_00318530
Length1675 bp
Sequence
GCTACATCATTTGTTATAATTTTGAGTAATATTTTATTTCTTTTACTATTTTTTCATGAAGAAGAATTTTCTAAATTCATTTTTTTTAAATTTTATGTAATTCCAATAATTTTTCTCTTCATCTTCAGGTATTGTACTAATAACATCACAAATTTATCCTCTTATCTCTATCTATAATTTATTATTATTATGGTTTAGTAACTTTTATATTGCTAATCTTTATTCATCACTATTTTAGAATCTAATCATAGCTTGGCCTTCTTTTAATAAATCATTTAATTATGGATGTTAATCTTATTAAATTAAATTATTTTCTATCTGGATATTACTGCACTATGCTGTGTTTTGCTGCTAAGTGCTTAAACTAATTTTATTGCTATTTATTTAATTACTATTTTCGTCTATATAGTCACAGTAAAATTCATATCCAAGATGTCTAACTGCTAAAACGACTTCTGCTTTTAATGTACCCTAAGGTATATTTATAATTTTAATTAAGCAGTTTTGTTTAATTTCAACATCAATAGATACAAATTCATCACTTGCTTTTCTGCTTTAGTTCATATTTTTATTTTTTTATTCATTCTGGTTTTTGCTTAGCTCCTTAAATGATTACTTTTCTTCTTACCATTTCTTATATGTGATGATTCTTATTGAACCTTGTCCTATTTTTTTCTCTGTAAGTAGAATGAGCTCTTTTGGAATAGAACTATTCTTTGTAATAAGAGCTTAATTAGCTTCTTCTTCCGAAAAAAACTCAATAAAAGCAAATCCCTAACATAACTAAGAATTCTTTTAGAGTGGCAAATTAATATTAATTATTCTAAAATTTCCAAAAATAGAAACTAATGTCTATTTAGAACATTTAGGAGGTAAAAAGTCTATATATAGTGTACGCTATTTAGAATTTTTTAGAGCTTGCTCTAAGTTAAAAGGAAACCTTCTTTTAACCTTCAAACTGTCCATTTTTACCTTTAAAATTTTACTCTCCTTTAAGGAGTCTCTTATTAAATGAATAAGATCTTTCTTTGAAAAGGTAGCATTCTAATTTTTATAGTTTTTATGATTTTTCTTTTATGATTGATTTTCGATGCCATAAGTAGAGACTATTTGTTTATCTTGAATCTGCTTTAAAATCTATTATATTTTATTGAATTTTAGAAATACCTTAATATCAACACAATTTTTTGGGCTTTTGGAAATTATTCCTCTTAAATACGAATCATGTGTCAAATTTGTATCGCAAAAATAATACTCCATTTACAATTTCAAAGACTCTTTAATGTCCAATTCTTCTGCTACTACATTATTAGATGAGCTTTATTCAGTTAAATTTTAGTAGTTTCTTTTAAAATTTAACTCTGTTATATGTGCCATACAGTCTTAAAATTGTTTAAATTTATCTTGATTATTTTATTATTACTCTTCAATCATTTCAACAGCCTGTTCTTTTTGCTAACTTATTTTTACATCTTAATTTAGTTAACTTTCATCATTCATTTGCTAATTTTCATATATATCATTTGCATCAACTTAATGATTTTCCTGCTCAACTACATCTTCATGTTAGTAGTCTTCCATGAAACATTCTTATTCCAACTCTTCAAGATTTGTATTTTCTAAATATTCATCCATTTTAACTTTTTTATCAATGAGGCTTAAATTTAGTATTATA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1263.5 L-2254.9 L-3209.9 S-0260.0 S-3201.4
S-6209.0 S-9157.0 S-12126.9 S-15178.5 S-24219.8
C-0199.6 C-2908.2 C-4417.8 C-6956.1 C-8838.1
C-10877.6 C-12445.7 C-14343.5 C-16179.9 C-18221.9