Summary
Transcript IDgene_000025146
Gene IDTTHERM_00218610
Length677 bp
Sequence
TTTATTGATAGAAAAATATGACAAAGAAAATGTTTAAAAGTTAAGCAATATCCTTAAAATGAATATAAAAGTTTTATTAGCAAAACCAGATAAAATTACTATTTCAGCAAACAAATATTTCTCAGATAATAGGAATAAAATGGATAAGACATTATTTGTAGTAGAAAAAAGCAAGTAATCTGTACACATAGCATATGATTCTTCAAATGAGAGATTACATAGATTCTGTTATTAAGGTAAAATAATCTATGAATAGAAAAATTAATAAAACCTAGAAAATACATATAAACCAATTAATGGTAATTAATTGAGTTAACAACATATTCAATTGTAATAAGAAAATGAAAGCTTAAAATAATAGATTTTGAAAATTTAAGAAGAAGAGGCATAAATTAAATAACAAAATGCTTAACTAAAATAAGAAGAATAAAAGTATAGAGAACAAGAGCTTTAGCTAAAATAGGTATTTGAACAATTAAGGCCTTTGCTATAAAATATGCTAAATAATTAGACCAAATAAATTGAGCAACTCTAATAGTTTTAGCCTACTCATAATAGAAATATTCCATAAAGTGATACTCTCTAACAGTAGCTTATTTAGTTAAATAATTCAGAGCTACAATTAAAATAATAATTATAATAACTATTCTTCCCCTAAAATAATTAATAGATTATCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-198.8 L-250.9 L-363.4 S-036.5 S-382.6
S-6112.8 S-938.2 S-1240.8 S-1543.7 S-2432.5
C-085.0 C-238.4 C-498.0 C-667.5 C-856.1
C-1092.5 C-1286.4 C-14105.6 C-16110.7 C-18154.6