Summary
Transcript IDgene_000025147
Gene IDTTHERM_00218610
Length1025 bp
Sequence
TTTTATTCTCCAAAATTAATTTAATAGCAAGTAGGTAACCAAAGCAATTATAATAATGATCTTTAAACTTTTAAATTTTAAAACAATTACTCAAACAATATCGCAGAATATGTTCATACTATTAAAACTAATAAGAGAGGTAATCTTTAATTAAATACTGATGATAATACATCAAACTGGACAACTTGTGATAAAATCAAAGAAAACAGAAACAAATAAAAAATTTAAGATTGTCCTATATGTTGCCAAAATAAATTAAATGAAGATCTTCTTAAGTTGAAATGTGGTCACTCATTTTGCTAAGATTGTTTAATAGAACATATTAATTCTTTAATTTCGCAAGGAAAACGTTCATTTGATTACTTTACTTGTCTTCATTGTAACTTAAAATTTAATCCTACAGAGCTATTTTTTATGCTTACAGATAAGTAAAGAAGCTAAATAGATGAATACTACAAAGATAGAAATATAAATTTCAAGTGTCCAAATTAAAAATGTGGTTAGTAATCTAAAATTCAAGAAAAAGAATGCTTGCTAAAAGAATTTTTTGTAACTAGTTGTTGCAAGTCAAAAGTATGTTCTAAATGCAAGCAATTATATCATCCTGACTTTAAATGCTAATCTTAAATTACAGAAATGATAGAACAAATTGCAGCTTATAGAAATTAATAAGCAACCGATAATGCTAGATTGTTCAGATTCTGCCCTGTTTGCTATTAATTTGCATTCAAAGATGAAGGTTGTGATCATGTTACATGTATAAAATGTAAATCAGATTTCTGCTTTAGTTGCTCTGCACCTAGACCATCTATTTTAGGTCATGGTAATCATTATCACAGAGAAGGCTGCCATTATTTCTGTGAGTACAAAGACCAAAAAGGAAATAAAGTAGACAATGAACTGAACCTAAAAAAATGTGTTTAATGTTAAAAAACTAAAAATCCATGCTAAAGACCTATAAGTTGGGATAAATTCCTTGTAGAAGTTCAAAATGAAATAGGTAATGAAATATTTGAAGCATTCCC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1319.4 L-2316.0 L-3270.2 S-0104.6 S-3378.6
S-6412.1 S-9376.5 S-12203.8 S-15164.6 S-24192.4
C-0604.0 C-2223.3 C-4316.5 C-6258.0 C-8234.2
C-10372.6 C-12392.5 C-14372.2 C-16431.4 C-18655.1