Summary
Transcript IDgene_000025212
Gene IDTTHERM_00220720
Length2744 bp
Sequence
TTTTATTGATTTAAAAAGTGGAATATTCCCAAAAAAATAAACTCACAAACATATTCTATAAATAATTTAGCTAAAATATCAATTTTTATTGTCTTCTTCCTAATTTATATTATTGTTATGCATATTTTATTTGTACACCCCTTACTTTTATTTGAAATTATTATTGTTTCCATACTTTGGCTGCTATTTTTACATTTGGTTATTAAAAATATACTAGCCATGATGATAAAAATATTAAATTTATTAATTATAATATTGCTGCTATTAGTGATAATTCAAGTTATTTTACATCTACATTTATTAATTGCTAAGCATAGGAATTTAATGAGCTATTTAAGGTTATTACTATTACTGATATGTTTAATATGTATTCTACTGCAATTTTTACATCATATTTCCAAAATACTATTGCTATTATTATGGCTACATTTGAGGTTGCTATATTTACTACTATGGCTGCATATTTTACATTATTGCATATGAATTAGGCTATACTTACTATTGTTATATTGGCATTAAATTATTCTAGTTGTAAACTTATTATTGCTAGTATTGCTAATTTATTGGAGGAGGAGAAGCAGGAGGGTTTGTTGTTTTCACAGAAATAAAAATAGAATCAATTTGGTCGTTGTACTATTTTAATAATTTTTGTAAATTATTTATATATGTTCCTTCTTAGGATAAATCTTCAAATTTTATTGATTTATCTAAGATATTTTTGAGAATTTCAAATATTATTTCCATCTTTAGCTAAATTTCTATTCTTGTTTCTAAGTTTGCTACTTTTATCTATTAAGAAAGTATACTGTCAATTTTATCTTCCTTGAAATTTACTTCTTCAATTATTATCACAATATTTTTGTTTGCAGTTTTGATGTCAAACTAAATAGAGCTTTCTTTAGGAGGAGGAGTGTTTCTTTACATTTTAGAGGAGTTATCAGGCACATTTTGTTAACTATTTTGGAAACTATTTAAATTATTAGAATTAGATACACTGCTGTTTGTTGGCTATACCTCAGAATATATGATAGGATTTTAGTTTTAGTTATTATATTATCTATTATTTTCACCTTATTATTTCATTTTATATATCTTTTGGTCATTGTTTGAACTATTATTGTGATTTTAACCTCCCTATCGCTACTAATGATTGTTTATATTATTGTTGCTAATATTCACTTTTTACATTTAGTTGCTGTTATTTTGACTAACATTACCTTCAACTTTTTCTTAAAATTCTTGCTTTTAGTGACTGTTATAGCTTTTTTTATTTTAACTATTATTGTTACTGCTTTAAACACTATAATAGCTGTTTTGATGGCTACTAATATTATTGATGGCATTTACATTTGAGCTATTTTAATAATTCTAATTGTTATTAGGATTGCTGTTATTATTTGAATTTATATTATTGTTTTAATTATTATTAGAATTGTTGCTATTATTTATTATGTTAGAAACTTAAGAATTGGAAGCAGAGTTTGTATAATTGCCTTATGAAGAAGCTTAATGGTTAGATAAATGCTATTATTAATTTTATGAGTGTGTATTGATTTATGAAGAAGTGTTTGCTTAGTTTGAACTATTAATTGGTGTTGTTGTGTTTGTATTTGCATTTGTATTTGAAATTGAAGTATTGTTGTTGGTAGATTATGTTTAAGTATTACTATATTCAAAATTTCCATGCTATTCTGTATTTTGATTAGAGGAATTATTTAATTTTTAAGTATAGATTATTTAATTACTATATTATTCTGAATTATTAGTGGCATTAGATCCTATTTTTTGCTAATTTATATGCTTTGGACTCTCTTTAGAACTCTGTTATACTGCTGCTGAATTGAAGTTAACGTTAGATTATGAAAAAGAGCCACTTATAATGTTTATATTTGATTAGCTATTATTTGAAGATAAGTTAGGACTTGCACTACTTTATTAAATTTAAAGCTTGCCTTTTGCATTGTTTTCATACGTAGCTAACTACTCAGTGCTTTATTAACTTTCAAATTATCCATGCGCTTAGTTAGATGCAGAATTTTATGAATTACAACTGCTATTATCATTTTTTTCCATCAATACATACTTATTTGTTTATTATTTTTAAATAGATTTGCTGTTTTATTTATTATGATTATTGCTACCGCTATAATTATTGCTATTTAAATTATTAGAATTAGGGGTTTTTTAATATTTATTCTTTTTAGGATAAGAGCCATTTTATTTCATTTGATTCTTTTTTTAATTATTTTTGCTGTTATTATTAGAGTTCAAATGCTAACTTCCTCCACCTTGCGAATTGCTATTTATTTAATCGAAATCGTATTAGTCGTTTTTTTTCCAAAATTCATCATCTACAGGCTTAACCGCATTACTTTTTTAGTTATGCGAGTTTTTATTATTCTATTTGTTTGACATTTTTATATCAAAGTATTAAAACCGATCTATCTTTCTATTATTTGATACAATTTATTGCTCTTTTTAAATAAAATGAATAAGCCTACAAAGTTAAACTTAAGTATAAAATTCGTTTGCTTGTTTGTTAGTTTGTTGTTAATGCTGCTGCTCTTACCTATTTTTATTATTTTATTTTTAAATTTTGTCTATCTCTCTTTCAAAGCTAAATAACTTTAAAGAAGAATGACTGTAATAGATTTATTTTTTATGAATGTTTCTTTAAGGTATTCAGAAATTTTTCTTTCTTTGTTTGTTAAATTTTTTTGTGTATCTGAGTTGTTCTTTATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,203.5 L-21,241.4 L-31,249.2 S-01,508.0 S-31,150.2
S-61,100.5 S-91,098.1 S-121,047.7 S-151,095.9 S-241,343.7
C-01,412.8 C-24,316.8 C-42,970.4 C-62,184.8 C-81,576.1
C-102,299.9 C-122,258.3 C-142,143.2 C-161,859.1 C-182,119.8