Summary
Transcript IDgene_000025227
Gene IDTTHERM_00221000
Length725 bp
Sequence
ATAATTGAAAAAAAATAATATAAATAAATACATACATTTACACAATATCATAAAAATATTAAAAAAAACATCAACAAAAATATTTCTAAGCATACACATGTTAGTAAACAAAAGTTAGAGTTCGTTTTCAAAAGATTTTTCAGTTTTCCAGAATTTTTATTCAATAATTAAGTGTTTTTATCTAATCCAATATCAAGATCGTTTAAAAGCTAAACTTAGTCATCTACTTCTTCAACTATGTTTTATCCACCTGTTTTTATTTTGTTAACAGTACTGAGCATAACTTATATTTATTTATCTTAACTGTCCAACTCTTATTGTTAGTATTTATAAATTTATTTGTTTGTCTGTCCTTCAATATCATATTTTTCTTAAAAGTTAGCTGGTTTTTACATTTTTTAATTTTTAGATGCCATTTTATCTTATTATATTAAAGTATCTAACTATTGTTTTTTTTACTTCTCAAGTTCAACTATCATGCTTCTTCGTTGCTCAATTTCTCTTGCAGTGAGTCCCAAGTTTTAAAGATTTCTTTCTTAATCCTGTACGAGTTAAGTAATTTTTAAGATATCAGATTCAAAACTTTTTAGTTATCCTCTGATTTCTGAATCAATAGAACCTAGAGATTTTCCTTAAATTTTCATTTACTCTCGCTTTGTTATGTCTCTTGTTATTGATAGCTATAACTTTTTTATTTGGTCATATTCTTATCTAAATTAATCTTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,096.5 L-2972.3 L-31,090.4 S-05,292.2 S-31,541.5
S-61,900.0 S-91,605.1 S-121,391.0 S-151,467.9 S-241,239.7
C-0328.9 C-22,736.9 C-4643.1 C-6633.7 C-8186.6
C-10287.7 C-12418.2 C-14288.4 C-16312.8 C-18268.0