Summary
Transcript IDgene_000025289
Gene IDTTHERM_00225720
Length772 bp
Sequence
GTTGAGATAATTATTTTTTTTAATTTATTTTTATTGGTTGGTTGTATAATTTATATTAATTTTATATAAACAAATTTTTAGTAAATCAATAAATGAAAACGATATAAAGATAAATAAATAAATACCTCAGCAACATTTTGCATCTTTTTCTTATTTTTTAGATTAAATTACAGGTTTTTGAATTATTTTAAAGTTATTAATTGGAGAAGATGCTTAAATTGTTTAGAGTGCTTAACTAGCAATACATTTAAATGCTTCTATGACGTTTGTTCCTTCCAAAGCAGAAGTTTCAAAAAATTTTACTCCATATTTTTGAGCTAACTCTTCTCCTTCTTAAGTTGAGACCTTTCTTTAATCTTTCATGTCAATTTTAGTAGCTATAATTACTATTTTAACAGATGGATCTGCTCTTTCGCTAATTTATTTCATCCAGTCTGCTATATTTTTAAAGGTATTAGGATCTGTTACACTATATGCAAGTATAATACCCATAGAGCCTTTATAGTAATTTTAAGTAATAGTTTTAAACCTCTCTTGGCCAGCTGTATCCCAAATTTAAAGTTTAACATGCTTTCCATCTACATCTTCATATTTATGCTCATAATCAATACCAATTGTAGGTAGATGTATTCTAGTAAAAGATTTTTTGCAGTAATTCACTAAAAAGCAAGTTTTTCCTACTCCTGAATCACCAAGGATAAGTAACTTAATTAATGTATCATAGTCTTATTTACTTTACATGATTTAAAACCTTCTGAAAAAATTTCTAATT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1492.4 L-2745.2 L-31,001.8 S-03,899.7 S-33,228.6
S-65,010.4 S-94,301.8 S-124,236.7 S-154,729.6 S-244,914.7
C-0239.7 C-2539.8 C-4291.3 C-6275.8 C-8125.6
C-1072.0 C-1262.5 C-14124.1 C-16397.2 C-181,095.4