Summary
Transcript IDgene_000025364
Gene IDTTHERM_00691200
Length1433 bp
Sequence
AAAAACTTTAAAATATTCTTTAATCAAACACAAATCTTAATATAAAGGTAAAAAATATAAATTTCATAGCAATTTTACTAAATATTAAAAAAGAAAGGCAGGAAAATTTAAGAATAGATTTGAAAATAAAATGGATCAACTATACACAGAAGATGAATTGACTGAATTCAAAAACGATTTGAGAAAGTTTAAGGAAATTGGAAATACTAAAGTTTTGGCCATCGTAAAAAGACTTTTTAATTGCCAAATCACAGTATAATAATTATAAAACACTAAAATTGCTTAAACTGTGTAATCTCTCTCTACTATGTCTTGCTTCGATGAAGATGAAGAAGGACAAGAAGCTAAATAAATATGCTCTTAAATTATTAACAAATGGAAAAAAATAGTTTAAAATGAAAAAAATAAGCAAAATCCTCAAGCCTCAAGCTAAAAAGCACCACAATTAACTAAATCAAATTCACAAACTGCTACTTTGCCTAGAAGATAATCCTCTGGTTAAGGTTCTACTGAAACATTTTTAACTAATGAGGAACCCTAATACAAGACAGAATCAAAAACTGATCTTCCTACTTATAAAAGTGATATTCGCTAAAAAGGATTAGAAGCTATTAACAAAATTTTTATGAAGGTTAAAGATGATATTAATGCTTCTCCTAGAGAATGGATTGAATTAATTGTAAATCTTGAAAAGAAAATTTTCTCAAGAAATTCCTAAGTAGTTTACTATAAATCTTATATTAAAGAAGTCCTTGGTATGTTCTCTTCTAATGAAGTTACCACTGAGGTTATTTCTAAAATGTTAAATAAAGAAATTTCACTTTAGGATGTTGCTGAAGCAAAAACTAGTGTCTTCTTGACTGATAGATAAAGAGCCTAGCAAAAAAAAGCTGTTGAAGATTAGCTTGCTACAAGTGATCCAGATTTTTATAACAATATGCGTAGATAGCGTTTACAAGGTCTAGAAGGTGAATTATGTAAAGGATGTAAGAAAAAAACAGCTTTCTTAGTAAAAGAATTATAGACTCGTTCATCAGATGAACCTATGACTCGTTTTATGGAATGCAATAGCTGTGGTAAAAGTTGGAAAGACTGAAGGAAGTAAAAGAAGGAGAATAAATAATCTTTTAAAATCATAGCTAAAAATTCAAATAATTTTGAATTAAAAATAGTTACAATCGTATTAAGCTATATAGTAAAATATAATTTTGAGAAAACTGAGCAAACTAACTAACCAGATATAATTTAAATATTATTTAAACATACTAACTCAATCATTCATTATTCAAAGTTTTAAGTTTGGATATGAATAATTTATTATAGTATATATAATCATTCATAATGCTTGCATACTTCTAAAATTTTGTGAGTTTCCTAATTTTAAATTTATGCAGATAATTTAATAAAAAATAAATAATCAATAGATCATAAAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,184.9 L-21,186.4 L-3903.5 S-0691.6 S-3556.7
S-6525.6 S-9512.5 S-12482.6 S-15559.2 S-24528.5
C-0645.7 C-22,898.7 C-47,470.4 C-66,874.8 C-85,320.4
C-101,737.5 C-12975.9 C-141,820.1 C-161,893.3 C-181,188.3