Summary
Transcript IDgene_000025424
Gene IDTTHERM_00691930
Length1124 bp
Sequence
TATATAGGTAGAAATAAAAAAGTAGAATAAAAGTAAATTAAATTAAAATCTGATTATTGATAGATAGATAGATGCTCGATTTTGATTAAAAATAACTTAATTAGCCAAAAAATACCATTCCGTAACTAAAAAATAGTCTGAATGAAGCATAAATACTTAAATTTAAAGAATTAAAACAGAAAATTATTGATGAAGCTCATACTTTGTTATGCCCAAAAGATGTAACCAAATTCGAAAGATATACAGAAGACAATTAAGCTGTAAGACTTTTATGGGCTCAAGATTTCCACGTCGAAAAGGCTTTTGCTATGTGGTAAAAGTGGATTTCTTGGAGATTAAAGATTGGTGCAGATGATATAAAAGAAGAGGATATTGCATAAGAATACTAAAGAGGAAGAGCTTTTTGGCATGGTAAAGATAAGTAAAATAACCCCTGTTTAGTTGTTAAAGTGAAAAATCACATTCCTGGAGTATCATCAGACATAATGGTAAAATATGTTTTGTTCTTAATTGAAGAGGCAATCTAGAAATCTGAAGAAGCTGGTACTGGAATGATATCAATCATATGGGATAGAGAAGGATTTAGTATAAAAAATGTAGATTATAAGCTCTTTGAAACATTCAAGTCGCTGAATTAAATTATTTAAGATAACTATGCAGAGAGAATTTAAAAAGTTTATATTCTCTACCCAAATTGGTTCTTCAAAACTATTTATGCTCTTGTTAAGCCTTTTCTGACCGAAAGAACCAAATAAAAAGTACTTTTTGTTGACTAAATTGAAGATATGACCACTTATTTCGAACCTAGTGAACTATTGATTGAACACGGAGGAACTTCGCCTTACAAATTTAATTACTAATTTGAAAAAGTAAATAAATGCATATAAGATAATGAACTATAAAGCAACGAAGTTGATTATAATCTACTATCAAATAATTTTAATTGTATTGATGTTTAATCTGATTAAGAAACTAGAACGGCCTTGGAAACTGAGTGCAAAGTATGACCACTGATTTAGAATTTTTGATATATATAAAAACTATTATTATTTATTATTTATTTTTACTTTTACTGTTTATCATTTATCGAATTTATTTTACTGATATCAAATAAAAACCTATAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-131.3 L-232.9 L-345.0 S-090.6 S-3474.0
S-61,075.0 S-91,043.5 S-121,914.1 S-152,464.3 S-242,500.9
C-03,230.4 C-21,604.6 C-41,564.9 C-6840.4 C-8808.6
C-101,824.8 C-12968.4 C-14564.0 C-16665.1 C-18836.4