Summary
Transcript IDgene_000025691
Gene IDTTHERM_00037190
Length1590 bp
Sequence
TTTTTTTTTCTTATTATAAATTATTTTCTTGGTTAGAATTTTAAAGGGTTTTTGAAGAAGTATTGCACTCAACAGTGCTATTTTAAATAACTGCTTAATCAATAACAGTATTATTATTATTATTATTATTTTTGCTGCTATTAGCATCATTTTGGGTATCTTAATTATTTAATAAACATTATTCATTGTTTTCTTCTAAATTGTTTATCTAAGGATCATTAAGTAGTAAGTTTTGGGAGGAAGTTGAATCACTCTTTTATTCTAATTTATTTAAATTAGTCAAAGAATCTTGCTAGCTTATACTCACTACTTATTGATTTTTGTTTGATTGATTTTTTGTGTTGCCTTTTTGAACATCATTAGTTTTACTTGGTTAATTTATTTGTCTAATGTAATTGTTAATTTTAGTTTAGTATCTATTTCTCTCTCTCCAACCAGAAGATAAAGCCTAAGTAATAAAATATCCTTGAGAAATAATTTTGAGAATGCACATTATTAAATTGCTAGAGAATTGATTATTAAAGTAAGATAATATTTTTGTTTTTTCTTTTAGTGTCTCATCTTATTTCATTTCTAAATCTTCCATAAGCTAATTTAATTAAATTGTATTTTAAATTTTAGTATATTTTTCAGGAATTATTTGATCAATGAAAATAGCTTCTTTGTTTATTTCATGTTCCAAGAACTGCAACTTGAATTACTTTAGAAGTGTTTTAACTTATTTAGAAGCGTATGACATTATAAACCCTTCTTCGGCTTTAGTAAAGTAATAATCTATCTTTTGTGAAATTACTTAAAAGTGGTCTTGCATATCCTACAGTTCATCTTCTTAAGAACTCACTGTAAATTCATAATGATCTTAGATTTTAACTTCTTTTTAATTAATTACAATAAAGTAAACATTTTTAAGTGCCTCGTGGCTTGTCTCGTTTGCATTCAATAAAATAATTCCTAAGAAAGGTTAAGTGAATTTAGGAATTTAACTTGAAGTTTAATTAATTTGCATGTTTAGTTCTTCAATCTTTTCATTTTTTTATTCAAGATTCTCTCTTTAGTTAAGATCTGCTTTTGACTATCCCTATTCTGTTTACAAATTTTGTCTTTATTGTTGGTTTTCATTGTTATTAAAGGGTGTTGAAGATTGTAATAATTTTTATCTAGTTTTAATTTAAATTTAGCTCTAATTATTTATCTAATTGCTACCATTGCTGCTCTTAAAAATATTTCCTTACCTTTCAGCTGAAAGCTAGCAATTCTAAGATTAAGGGTTTTAATTATTGCTATTGAACAAATATTAATCTCTATTTTATGCAATTTGTTGGCCTTTTTCTTATTAACTAAAAAACATGCTAGCTACTCTTTCACCTTAAACTTAATCTTAATTCTCATTTATTAAAAGTTAATTGCTATTTTGTTGATTTTAATTTATTTAGTTTTATGGAGGAGGGTTTTTCCTCATATAAACAATGCCTTTGCTTGAGTTATTTCCTTTAGATGTACTCATTCCCTACAACTTGCTAATATTTTGCTTGATATTAAAAAAAATGATAGCGCTATTGAACTTTTACCAAGAAAATTCTTGTGTTTCTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-197.5 L-269.5 L-364.8 S-051.8 S-3108.2
S-642.8 S-954.8 S-1295.8 S-1561.6 S-2483.6
C-0152.9 C-2788.7 C-4507.3 C-6182.3 C-8303.9
C-10257.8 C-12161.8 C-1491.7 C-16115.2 C-18134.8