Summary
Transcript IDgene_000025930
Gene IDTTHERM_01013140
Length1842 bp
Sequence
AATCAAAAATTAAAATATCATACATAATAATATCCTTTTTAAGTCAATTTATTGAACTTAAAATTTACATAAATGGATAAGAAAGATGTTCAATAGACAACATTTGATTTTGTATTTGATGCTCCTATCTACTCAGAATTTCTACCTAATAAAGACATGAATTATTATGATCCTTTGAAGACAAAAATAAATGAGAAAAGCGAGCTTGACTAGTGGTTCTTAGTTTATCATGATGATCATTACTAAAATAAGGGTTAAAAGTCTAGGGGGAAAAAAAATGATAAAAATTAATTAGATAATAAGGTATTTCCTTTCGTAAGATCAAAGGGTGATTAATTGCCTAAGACTAAAAAGAGAAAATAAATTAGCACTGATGATTATTAGTAAAAACTTGAAAAAATATAATCTTAATAATTGCCTTTAAAGCAGTAATCAAAATAGATTAAGAGGCAAACTAGCAATTTACCTGGAGTTGAGAAGCCCAATGAAACTAATAATGTTTAATAAAGCATGAGAAGAAATTCTAAAGATGATAAATAAATTGTTTCTAATACTATTAAAAATATTCCTGAGAGGAAAAACAGAATTAGTACTTAAAGTAGTAGCTAAGTTAATAGAGTAACCAGATCGAAATCAAATAGCAAAGATATTAAATCTTTCTAAGAAATACCTGCCTCTATAAAATCTTTGAAGCAAGTGAAAACTGAATAGCCTTTGAACTAAAAATAAAAAAATAATTAAGGATAAAAAATGATCGTTGAATTTGAGTCAAGATCAAATGATAGCACTTAGTAAGAAAACTCTCAAGAAACTAAAAAAACTGGGATTTTAGATTCAAAACTCTAAGTTATAAATGAAAAGTAAGATGCAGAGACTATTTAAGTTGACGTTCTATCGGACAACAATAAGATTAATTGGAAAGGTTCAAAATAAAAAGATAATAATTCATCTATAATGGAGGAATGTCCATCTAGTAAGGCAAGCAAAAAATCTGGAATCAATTTGGCTGACAACAAGGTAGAATTAACTTAAAATAATAATTAGAATTAGAATAATAACTTAAACTGTGACTTTGTGAATAAATTAATTAATGACTCTCTTTTTAATAATAAAAGCACAATGTAGTTGGCCTAAGAGATGGCAAGCTAAAAAAGCCATAATAGAATATATAGCAACATAGAAGAAGTAGATCAAGCAACTAAATAATCTGATAGCAGTAATTCTTGCATAACTAATTTATTCAATTAAATAGATACTTAAATAAATAATCAATTACTAATCACTCCACATAAAAATACTATATGTGCTGAAAATAAAATAAATCTAAAAGGCTCTACTCCTCTTTTATCCAGCCATTCGAGAGAAGATCCTACTGCAGTTTTCTTAAAGCTTTAATAAATAAATGAAGATGCATTTTAAAAATCTTAGAGAACTAGAACTAACAAGAACAAATTATTAGTTTCTGAAGATAAAAATTAACTTTCTTAGTATAAAAGACATTAGTCTTTGAATATAAGCAAACCTAGAAAGAGTATTATTTTAGATAATAGCGTTTTAGCAATTTCACATAAAAGAAAATCTGAAGTTGTAAGTGTAAAGAGAAGTAAATCAATAGATGAGTAAAGATAAGATCAGCAAATGAAGGAATTTGAGAAGGATTGGGAGAAGAAAAATGGAGTTAAATTATATATGTTAAATTATTAAAAGAGAAAGGAAATTAAATAATTATTTTTGAACTAAGAGAAAGACAAAGTAAATATTTTTTGAAAATATTAAAAATATTTATTTGTTTGCTATATATCTATTTTTGTAATATTATTGATAATGTTTATAAAAATTTAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-188.2 L-2101.7 L-394.5 S-056.9 S-360.3
S-652.2 S-978.7 S-1269.0 S-1563.3 S-2459.8
C-052.7 C-29,445.9 C-43,207.7 C-63,382.6 C-8699.7
C-10449.1 C-12955.5 C-14519.2 C-16232.7 C-18124.0