Summary
Transcript IDgene_000026048
Gene IDTTHERM_01035700
Length428 bp
Sequence
AATAAAAATAATAAAAATCATCAATACAAATAAAGAAAATATATAGCTCTAAAATGGGATTACCAATTAGAAATATCCAATTCGCTAGATATCACTATTTAGCTGCAGTTACCGTTTTCACTTACTTTGCTACTCGTTGCTGCTTATTAGATTACAAGAAGTACTATCCTTTAGCTTCAGTCAAGAAGATTTGAATTCTCTGAATCTTTAAGAGGGTTTTTATAATTTTCTCTAGATTGAATCATTAGATTAATAGCATGTAATAAAGCAGTAAAAACGGATCAAAATAGTTAAACAAACGATATTAATTTATAGAATTAGAAATAATAGTAAAATTGATAACTTTGTTGCTATTCGTATATGCATGTTTTAATCTAAAGTATTGCACTATCTTATCACATTATCCTATTATTAAATTTATTTCTCCC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-18,913.9 L-210,334.8 L-310,184.2 S-08,383.5 S-34,405.6
S-62,517.9 S-92,561.3 S-121,967.9 S-152,449.9 S-241,072.5
C-0697.0 C-2927.1 C-41,324.2 C-62,019.7 C-81,347.7
C-102,169.0 C-121,943.0 C-141,092.5 C-161,122.2 C-181,009.0