Summary
Transcript IDgene_000026118
Gene IDTTHERM_00532080TTHERM_00532090
Length1159 bp
Sequence
TGAGGGAAAGTAGAAAAATAAGGTTAAATTGAAGGAATATAGGAATTATGATATGAAGGAGACTGCGAAATGACATGCATTAAAAGATTAAGGCTATGCAAATATACTATTTCTGCTTATTTGTTGGAATATCTGAGTTGTTTTTTTGTACCTTATATAGGCTTTCTTTTGATTTTATGTATTTATTTTGTATATAGATCCTTAATAATTTTTATATAATTTATCATCACTATCATGTTAAAGACGCATGCAATAAATAGAAAATATATCTCCTCTGAATAAATTCCAATACAACAATAATCAATCAGATTCGCTAATATTTAAGTTGACTACAAATATTGCTTATGTTAAATGCTAATGATTTATATTTTAATAATATTATTTATAAATTGCTATGTTTTCACTCAGAAGGAGCTTGTTCAGAAACAAGAGTGATTAATTGATTGTATAAATCTTAAACACTCTAGCTTGAGTTAATTTCTTTTTAATAAGCAGCCTTCTTCTCAGCAAAATGCTTAGCATTTTTTTCCAAGAGAGCCTTAGAAACTCTGTATTAAAGCAAGTAATCCATAAATTCAATAGACTTAAATTGAGAAGTCTTGTTGCCCCAGGTGAAGGCAAGTTCTACAGCAGTGGGAAGAACAAATAATCCCAATCTGAATGAGTAGGGTAAGTTAAAAAGATGAGCAAAAGCAAAGAAACCAGCACCTACAGTCATACCTCTCACAGGCCAAAGAAGCTTAGCATTAAAAGTGAGGTTCAAATCATTAGCAATATCAGGGTTAATTTATGTATAGCTGCTGACTTCTTCAGGATAAATCTTACCTAATTATTATTTTCTACGTAAAACTTCCAATTCAAGAATATCTTTTTAGAAATATCTGGGATACATCCACTCACCAAAAACAGCGATACCTCTTTAGGATCTTTGGAGGTGATAAGTGGTAGCATCGATTCTATTTTAATATTCTTCATAATTTTGTCTCATATCCTTATCCCATTTTGCTAAGAAAGGATATTCGTTTTAATCAACGTTTGACTTAAGGTTTAATCTGACCATCTTACTTACTAATTATTAATTAATAATTTTTTTCTTAAAAGATCTGCTTTTCTTCTGATTGTTTCTAAATCTCTTTTGATTTTTTATTTATATTTATTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-119,389.1 L-219,118.9 L-325,794.0 S-013,473.0 S-37,409.3
S-64,513.5 S-94,233.8 S-123,551.1 S-153,586.0 S-242,292.6
C-01,459.7 C-22,185.5 C-42,390.1 C-61,671.9 C-82,280.3
C-103,361.8 C-122,289.1 C-142,259.2 C-163,192.4 C-182,456.2