Summary
Transcript IDgene_000026148
Gene IDTTHERM_00532540
Length740 bp
Sequence
TATACAGTAGTATGGAGCTAAATGTATTGGAGATTCTCTCTAATAGCTAATAAATCTTAAATCTTTGATTTTATAAATAGAAAAAAATAATAACATAGGATGCGGAGGTGCAATTGGAATCGCTCAAGGACTTTCATCTTTAAAAAATTTAAATGAGCTTTAATTATCTTTAGGATTTGATAATAGTATTAGCTCATTAGGTATGACATCTATAAGCAAAAGCATACAATAAATAAACAATTTAATTAGATTGTCTATATCTATTGGATAAATGAACAATATTAGTAGGGAAGGTGCGAAATCTTTAGCAGATACTATTAAGTTGTTAAAAAATCTTAATTTTTTAGAGCTTATAATTTATGATAATAATATTGGGCCCGAAGGATCGAAGGAGATTGGTTTAAGTATTGGAAATTTGAAAAATCTAACAGAATTGTAATTGCAAATTGGAACTAATAACATATCAGACGAAGGAGCATTAGGAATCGGAATGGGATTACAAAATCTAGATTAGCTTTCATGCTTGAGCCTCAAGATAGGACCGAATAATAACATAGGGCCATCAGGAGCTCAAGGATTAGCTTATGGATTATAGTATCTAAATAATCTTACAAAACTTAATTTATAAATCGCTTCTAGCAATAACATAGAAAACCAAGGAGCGAATGAAATTGGTAAAAGTATATAACTTTTGAGAAAACTCTACTAATTATCAATAAAGATAGGAAATAACAATATAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1273.1 L-2235.3 L-3295.3 S-0982.0 S-3559.8
S-6604.7 S-9813.8 S-121,068.1 S-151,203.4 S-241,487.8
C-0152.9 C-2461.9 C-4208.5 C-6165.7 C-8234.2
C-10250.9 C-12142.8 C-14117.0 C-16222.5 C-18326.2