Summary
Transcript IDgene_000026149
Gene IDTTHERM_00532540
Length764 bp
Sequence
ATACATTGTAAATGATGAATCTAGTAGCAGCAATTTATAATAATAGTCTTATAGCTTATCTCTTTAAATACAAATAGATCAAGAAAGGAGCTTACCTTAAAGCATAGGGTTATTTGAAGGACTTTCAACCTATACTAATTTAACTTCACTCTCACTTAATTTTGGATATAATAATTGCATATCAGAAGAAGGTGCTTGCAGCTTGGCTACGTGTATTTCAAAATTTTTAAATTTGAGGTTACTTAATTTATATATAGGAAGCTTCAACAAAGTTAATAAAAAGGGGGCTTCTAAAATAGGAAATAGTCTCAAATGTTTGAATAATTTGGAATAACTCTAAATTAATTTTGGTGGATTCAATGAAATATAATCTCATGGTTTTAGATCTATTATTGATGGGTTTAGTTAGCTTTCTAGCTTAAAACATTTGGAGTATTAAGTTTTCAATCCAAACAACATAAATTCAAAAGACATTAATTATTTAGCATGTGCTATAAAATCTATGAATCATCTAAACAAGCTACAACTTAGAATTAATGATTACTAAAATATATACGAATCCAATTGTTTAATTGCTTTAGCAGAAAGCATATCTTACCTTTCTTCACTCAGGAGTCTCTCATTCAATTTGAATTAATGGCAGATGTTTGACCCAAATCTTTCTTTTGAATTATGTAGATTCATTTTTGATTTACCTTTCTTGCGTTTCTTACAAATAGAAGTGCCCTCCTAATTTAAAAAGTACACATAAAAAATTATTTTCC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1350.0 L-2260.5 L-3372.8 S-01,010.2 S-3703.0
S-6895.7 S-91,030.6 S-121,259.9 S-151,434.2 S-241,698.1
C-0103.4 C-2653.6 C-4245.3 C-6129.0 C-8229.8
C-10242.2 C-12155.8 C-14156.1 C-16236.7 C-18397.3