Summary
Transcript IDgene_000026210
Gene IDTTHERM_00448720
Length1151 bp
Sequence
CCTAAAGGAAGTTCAAATAGATTAAAAAAGCTAAAGAATTTTAAACTAAAAAATGTCTAATCAAGAAAGATAATTCTGCTTAGAATATCTTATTACTGGTGCCCATCAGTAACAAAAGAATTTGGATTGCGTTTTTTGCTTCCCTGAAAAGCTGTAATAGGAATTTGAGAAAATTCAATAAAAATTGAAAGAAGAATAGGAAGAAGAAAAAGATCTACCAGACGAAAATGAATTCGACGATGCCTATGAAGACTTAAGAAAGTAAGCAGAAGAAGAGGAAGAGGAAGAAACTTAAAATTTAGTTGAAAAGAAATTAGAATAATAAATAGGAGAAAAATTACATCACATTCAATAATAAAGTGTAGAAGCTTTAGATTAGTTGCTATAGAATGAAAAAAATATTGAATTTATTTTAGACACTTCAATGGGTTTGGTAATTAATCCAAACAACGTTAATGAAAGTCGTTTTACTTTGGCAAGAAGAGTGCTTAGTTTGACACTCGAAAAGTGGTACCCACAATTAAATAAAAATGGTAACTAATAATAGAGATTAGAAAATGAATAAAGATATTAATAGGAATTAAAGAAAGAATTTAATATCTATTCTTCTGAATAAGATGTCTAGCTAAGCAAATAGTTAGTTTAAATTTCATAGGTGTAATTAGCAGATGAATTTTTAGAAAATATTTAATTACATGGTAGAAAAGACAGAGTATTATCTACACTTTAATCAAGAATTTAAAACTGTCCTCCTTAAATAACTTCTATTATTGTTTTTACTGACTACACATCTAAAGATTACTCAGCATGGAAACAATAAATTGAAGAAGCAATCAAACAAAGACAAAATGCTCCTAAAATACACATCATTAGTTTTAACTTAGCTGGGCCTGAAAAATAAGAAGATAAATAAGCATCTTTCGATTTCTTTGAATCAATCAGCAAATTAACTAATGGCACTTTCAAATAGTTTAGTTCTTTATGATAATTCATTAATCGCTTAATAACTTAAATACAATAAAATTCTAATTAATAATTAAACCCTTAAAGACGTTTACTATTTATTTTTCAAATATTATTTTTATTTGTCTAAATATTTTTATTTTCAATTTTAGCAATTCTAATTTATGTTTAGCAATAAAAACATCCAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,947.4 L-22,053.8 L-31,868.0 S-02,291.4 S-31,385.9
S-61,480.8 S-91,242.8 S-121,364.6 S-151,428.1 S-241,332.6
C-0792.4 C-21,477.2 C-4909.6 C-61,620.1 C-81,022.6
C-10785.5 C-12685.7 C-14847.1 C-16769.2 C-18736.4