Summary
Transcript IDgene_000026215
Gene IDTTHERM_00448890
Length617 bp
Sequence
TAATTACCTTGCTATAGTTCTTTTTATAGTCTTTCAATATAGTGAAGGGCTTTATTTAAACTATCTTGAGCTTTATTATGCTTGTTTAAATTGCTTTAAATGGCAGCTTTATTAAACAAAGTAGAAATAATACTGTTTTTAGCATTAAAGTCGTTATCTTAAACTAATCTTTCTTCTAATTCAAGAGCAAAGTGAACAGCTTTCAAAGCCAAAACGTATTGCTTGCGCTTTTAGTAAATGCATGCTAAATTGTTAAATGTTAAAACTTTCATTTCTCCATATTTTATAACAGGCTTAACAAATTTGTGAATTGATTTATGCATCAAAATATCAACAGCTTTCAAAAGAAAGTGAATTGCCTTTTCGTTATTATTGCAGTTGAAATGATCCATAGCTATTTTATTGATAGATAACGCATAATCAATGAATTAATCAGAAAAATTAAATGGAATATCTGCATATCCTAATCCAGCCGACAAATAATCTGTGCATAACAAAATTAATCTCTCCTAATGCAGTAATTTATTTTCAGAATTTGGATCCTTTTTCTTCTCAAATTCCATGACATTATAAAGTAAGCTAAGTATCTAGCTTCTGTCAGGTTTACTCATACTGTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1468.6 L-2534.1 L-3456.1 S-0671.5 S-3315.8
S-6443.4 S-9257.7 S-12188.8 S-15241.6 S-24158.8
C-0129.5 C-2214.5 C-4100.2 C-680.3 C-8104.0
C-1075.6 C-12118.7 C-14176.4 C-16161.8 C-18163.4