Summary
Transcript IDgene_000026423
Gene IDTTHERM_00374960
Length1136 bp
Sequence
ATTTAGTAGATCATAAGAAAGTATACTACTTTAGTACTTCTAATATACACCATATAGCTAGCTGCTATAAACACTATTAAAAAGCATATTGATCATAAACTGAATATAAACAAGTTCTACTTGTGAAATAAGCCATAAGTTTATAAATAAATTAGGTTTTATAGATAGCATCAGATAAATAAATTAAAAACACTATCTCTTAATTACAAATAAAATGTCATCAAATATAGAGGATTTAATGAATAAAAAGGCATAGGAAATTAAATTAGAAGAAAATAAATAAATAAAGCCAAAGATCCATTATAAAAGTTTTATAGCTGGAGCGATGCTTACATTTATAGCACAACCTTTTGAAGTATTGCGTACATCTAGCGTTTTTTTGAATCATTGGGGAACGAAACCTTCTGAGATTTTAAATCTATCTAAATTTATATATCAGAAAGAAGGTGTAAGGGGATTTTTTAGAGGAGGAACTATAGCAGCTGTAAAAAGCTCATTAGGATTTGGAGTATTTTTTAATGGTATTCAAAATATCCCTTATATACTTAAAACTTAAACAAAAAGCCCAGAACATTATATTTATAACTAAATTGTCAACTTTATAAATGGCTCGAGTGCTATGTTTTTTACAACTATGGCTTCCACTCCCTTAACAGTATTGAAGACTCGTTTTGAGGTTGTAGGGTAATAAGAATACACTTCTGTTATATAAACTACAAAAAAAATATACGCTGAAGAAGGCTTAAGAGGTTTTTATAAAGGAATAATTCCAACATTAATGAGAGATCTACCCTGGAGTGGAGCATAATATTCAATATATCAATCATTAATTAGTATGTACGAATATTTCCTATAAAAGCCAGCGAATGAAAATAATTTATTTATATTTTTATCAGGAGCACTCTCTGCAAGTGCTTCTATTATGATTTTCTATCCATTTGATAATATTAGAGTGAGATATTAAGGAGTAAGGCAATAAAATACTCCGCTTTTGAAGTTAGCATATCATATTTATTAAGTTGAGGGCTTTAAAGGCTTTTACAGAGGCTATTTACCTCGTCTTTTAAAGAAAGGTGCTTAGGGTGCTATTGCTTGGACTATATATGAGTATTTAAAGAAGGATTAGAAAAAAAAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-14,569.2 L-24,215.9 L-34,544.3 S-01,494.8 S-3316.2
S-6422.2 S-9434.5 S-12300.0 S-15323.0 S-24286.5
C-0239.7 C-2220.4 C-4725.2 C-6546.7 C-8672.6
C-10614.6 C-12293.5 C-14299.9 C-16287.8 C-18254.6