Summary
Transcript IDgene_000026515
Gene IDTTHERM_00188760
Length359 bp
Sequence
GGGATATTTATTTAACAAAAAAGAAATGTATGATAATGATGCAATTACGCTCATTTAGAAGGCTGATTAACTTGATCCTAAAGACAGCTGGGAGGGATTATCATTTCTGAAAAAAGAAATGTAATAATGATGCAATTATATTCTTATAGAAGACTATTTTACTTGATCCTTAAGACAGTTTGGCATTTGGAAAGCTAGGATTTTTATTTCAGAAAAAATAAATGTATGATGATGCAATTAAATTCTACTAGAAGGCTTTTTAAATTGATCCTAAAAACAGTTGGGCATTTGGAAAGCTGGGATATTTATTTTATAAAAAAGAAATGTATGATCATGCAATTCCATTCTTCTAGAAGGCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,035.0 L-2432.7 L-3725.2 S-0658.1 S-3624.6
S-6650.8 S-9285.4 S-121,203.6 S-15866.0 S-242,062.3
C-01,572.0 C-2996.4 C-41,215.6 C-6548.2 C-81,122.4
C-10607.5 C-12370.6 C-14442.3 C-161,498.3 C-18572.5