Summary
Transcript IDgene_000026765
Gene IDTTHERM_00962060
Length1256 bp
Sequence
TAAATTATTATAACAAAAAACAATAAAATACAATTTAAAAATTAGTCTAACAATTAAATAATACATAAGTATACATAAATAAATGGAATATAGATTTTTAGGAAACACTGGTCTCAAAGTCTCAGCTATCGGTTTCGGAAACTGGTTGAATAGTGATACTTCTGATAGATAACAAAAAATGATTGAACTCGTTAAGAGAGCCTACAGCCTTGGAATCAATTTCTTTGATACAGCTGAAGTTTATGGCTTTGGAGAAGGTGAAATCTAATTTGGAGAAGCCTTCAAAGCTCTAGGAGCTCCTAGACAAGAATTAGTCATCTCTTCTAAGATCTTCTGGGCAGTTCCACCAACCTCATCTGATCTTAAAAAAGTTAACTAAATTGGTTTATCTCGTAAGCATATTTTCGAAGGAGTGAAAGCCAGTTTAAAGAGACTTCAATTAGACTACTTAGATGTTGTCTTTTGCCATAGATTTGATGAAGATACTCCCTTAGAAGAAACTGCTAAAGCCTTTAACGATTTAATCGAATAAGGACTTATTCATTACTGGGGAACCTCAGAATGGTCAGCTAGTGAGATCTTTGAAGTCAGAGAAGTTTGTGCTAGATTAAATCTCACCCCTCCCGTTTCTGAACAACCATAATATAGTATGATGGTTAGAGATAAATTTGAAGTTGAATACGGAAGACTCTTTGACAAGTACAGATTAGGAACTACAGTTTGGAGTCCTCTCTGCAGTGGTATCTTGACTGGAAAGTATAATGATGGAACCCTTCCTGCTGGATCAAGATTATAAGAATTCAAAGATAATATCTTCTTGAAGAGAATTTACGATTAATACTTTGCTGAAGATAAGAAAGAAAAGTTATTAAAGCTCCTTAATGGCCTTGCAAGTGTAGCAAAGAAGTTAGGATGCACTTAGTCATAATTAGCTATGGCTTGGGTTCTTGCTAATCATGATGTTTCTACTGCAATTACAAGTGCTACTAGACCTGAATAGATTGATGATATTGTTAAATCAGTGGAAGTTATCAAGAAAATAACACCTGAAGTGAACAAAGAAATTGACGAGATATTAGGAAACAAGCCTATGCCTGGAATGGATGTTAAATCATTTGGACTTAAAAAACACACAAGAAGAGAATTGATGATTATTAAAAATTAATATTGAATACAATTTATAAATTGAATGATTTCTGTTCTATTTTTTGTTTTTTTATAATGAAATTTGATAATAATTAAAAGAAAGATATTTA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-18,007.6 L-28,757.4 L-312,503.9 S-05,453.5 S-310,771.4
S-66,340.5 S-94,325.2 S-125,102.0 S-153,879.4 S-242,336.1
C-06,952.5 C-23,352.0 C-42,196.1 C-61,099.0 C-81,878.1
C-104,195.5 C-124,559.9 C-146,194.7 C-168,202.6 C-186,452.7