Summary
Transcript IDgene_000026776
Gene IDTTHERM_01027480
Length594 bp
Sequence
GAATCATTTTCTAATAATTTAACAAGGGGAGGAGCTTACGGGATGATAGGAGCAGCTCCCAAAATAGTTGAATTTCTTTATTTGATCATACTAGTTTTGGTTGTTGATGATTAACGAAGTCTTGAGGTTGACTAGAATGTATTTGCATTTGTCTGGCTTACATGAATCAAAGCTGCATTTTAAGTATTTATAACAGAATTTTTTCTTAGCATTTCAAAATTTGCTTCAGGATTAGATATAGGTTAAAATTATTACTTTTGTTGAATCATGTTTTCATGAATTTCCTTTTTTCTTTTGTATTTGCTTAGAAATTCATTTATAACATTATTTTTTATTCCTCCAACATTATTTTCATAATCTTTCTTTGAGACGCCTGCCTTCCTTAATATATCTTTTTCTGCTTTCTTTAACTTTCCATTTAACAAACGTGTCTCTTCTTTTTCTATATTAATATCCTAAAGTGGCTTATCATTTTCAAAGTTTTCTCTCAACTTAGAATCCTGAGCTAATTCAGGATAATTCATTTCTTCTATTTCTTTCAGCTCTTTTTCTTGATCTGTAATAAACTAAATTTCTTGATAGAGTAAATCAGCT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1813.5 L-2906.3 L-3746.3 S-0532.7 S-3606.1
S-6711.1 S-9841.7 S-12841.1 S-15748.6 S-24584.0
C-0514.7 C-2328.5 C-4419.5 C-6506.8 C-8622.1
C-101,576.3 C-121,238.2 C-141,651.9 C-16881.3 C-18961.7