Summary
Transcript IDgene_000026777
Gene IDTTHERM_01027480
Length327 bp
Sequence
TGAGAATCCTATTAATGTTTGAGTATTGCTTAAGCGGAAGTAATAAAAAAAGTCATTTAGTTTGAAATAGAACTCATGGAAAAATTTGTAGAGATACAAACGAAATGTGACATCAAAGGTGTTCAAATCAAACATATAAAAAACATCTCTTCCTTCTTTTAATTCATCTGATATTGATTTATCTAGCCCTAAAGCCAAACCTCCTTATAAATTTGAAAAGGACCATCTATTGTTTGAAAAGAACCATATTCTGCAAGCAGCAATAAATCTTATTTCGATTTATTAACCCATTCTTTGTTTGATGTGATCAAAGATGTCTCTTGAAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1154.8 L-2192.2 L-3112.6 S-078.7 S-373.8
S-676.2 S-966.6 S-1267.8 S-15163.2 S-2496.8
C-085.5 C-236.5 C-455.6 C-654.6 C-879.3
C-10208.7 C-12202.3 C-14265.8 C-16172.5 C-18186.7