Summary
Transcript IDgene_000026960
Gene IDTTHERM_00438880
Length1350 bp
Sequence
AGAAAAGATATTAATTAAATAATAAAAAAATTGAAATCAATAAAAAAAAAATACAAATTCTAATAATGGTAGCAAAAAACAGCTTTATTGGACTTTTTATTTTTTTAAGCTTAATTGTAAGTACACAGGCCTCACTTTCAATCCCTTTATATTATAAAAATATTTCAATTAAATATAGTATGGGAAAATGTGCCGCTTTTTTATCTGTCTTAATAGATTCTTCTCATTCTCTCTGTAATAATAACATTTATCTAAACGGTTAAACATAATAATGTGGAGTTGTATAATTACCTGGTTCCTAAAATTCAGTTGCTAACCTTCAATTTAACAATTTTGAAGCCACAGTCGTTTTTTCAACTAAATATTTATCTACATCTAGCGATAGCGAGAATTTATGCTTTGGAAATGCTCAATAAGAACAATTATCATTTGTGAAGTAGCTACAATAATAAAGATTGATTTCTTAATAAAGAGTCTACATTACTTTATTCGATAGATACCTTTAATAAGACCCTCCATCTAGCATTATTGGATACATTAACTTAGAAGAACCAAATCCAGACTATATCAAATAAGGTTCTAGCTTTGTAAAGATATTAACTTCTGACAGTCCATTTTTATTTCAATTAAATGGATAAATTACATTTTTTGATTAATTAATTAGCGTCGCAAGCAATAAAATCTAATTAAAATTCCCTAATTAGGTAGATAATTAATTTGACTAAGCTACATGTGACTAGGTATTTAAAATTTTATAATAAAACAATTTTAATGTTATAAAAGATAGTGGTAAGTACTATTTGCTTTATATTTAAGGCTTAGGACCTATTAAAATTGCATTGTAAACTGAAAATAATAATCCTTACATATTATCTATAGACCCTTCTTAATATATTGAAGAAATTATAAAAGGATATTATAGGTTGAGGATCTAATGTGGCAATTCTTTTTGGCTCTCTTAGAGTGTTTTAACTTCATACTATGTTGGATGGGATCTAGAAACTCAAAGTACCTATATTGCAGAAAGAGTTGAAGGTTTAAATCCTTAATATGCAGCTTAAGATGCTTAAAGTTCTTCTAATTTGAGAAGTTTAAATATTTGAAATAGAAAATAATTATATAAATTTTACAAGGACCCTGTTTTTTCTTATTGTTAAAATCAATATACTGTATTTCCTCAACAACTAATACCAATCGCATCCCTTATTTTTTACCATTTTATTTGGTAATAAATAGAAATATAATATTGTTAAAATTAAAATTTTTTTATTATTAATTGTTGTGAATTTATAAGGTGTATAATCTGTTATGAAGAGTAAAGAATATAAAATTTAGAAAGAATATTATAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,920.0 L-22,979.6 L-35,771.1 S-0717.6 S-33,326.0
S-63,820.1 S-93,614.2 S-123,767.8 S-153,016.2 S-243,601.3
C-06,075.9 C-2930.7 C-4752.1 C-61,163.0 C-81,180.3
C-101,900.7 C-12903.8 C-142,787.9 C-165,629.9 C-186,785.7