Summary
Transcript IDgene_000027018
Gene IDTTHERM_00245080
Length877 bp
Sequence
TATTTATTAAAATTCATATCTTTTATTCTTAACAATTAGCATAAAAATAATATTAAAAAAAAGAAAAAATGGCCGAAGAATAAGGTGATAACTGGTTCCCTCTTGAATCAAACCCTGATGTTATTAATCCTTACGTATAAGGTTTAGGATTTGACACAGCATAATATTCATGGTGTGATTTACTTTCAGTAGAAGAATGGGCTTAGGAAATGGTCCCAAAACCATGCTTAGCAGTTGTTTTCTTGTATCCAATTAGCGAAAATACAACAAAATATGATCAAGAAGAAGAGAACTAAGAATAATAGGTTCACCAAAGTGTTTATTTCATGAGACAATATGCTAGAAATGCTTGTGGTACAGTTGCAGTAATGCATGCTATGTTAAACATCGATCCTAGCTTAGTATCAGCTAACTCTGTTGTAGATAGATTTAGATAAGCTACTAGAGAAATGACTCCTGAATAAAGGGGAAATTACTTTTTGACATGCAATGACTTAAAATAAAATCATTAACAAGCTGTTTAGTAAGGTTAATGTAGCATTCAAGAAGAAGTTGATACTCATTTTATTGCTTTTATCCAAAAAGAAGGACATATTTATGAGTTAGATGGAAGAAAGAAAACTCCCATTAATCATGGATAAAGTTCTCCTGATACTTTCCTTCAGGATGCTTGTGTTGTTGCTAAAAAGTTAATGGACAGAGATCCTAGCTAATTAAACTTTACTTTGGTTGCTTTAGCAAAAACACAAAATGAATAAGAGTAATGAAATAACCAAAAATGTTTAAAATTATTATTAAAACTAAATCAAAGCTTTTTATGTTTTATATAGAGCATTTAATTAAGTATTTACTGATATTTGTTAAATTTTTCTTAGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-13,434.4 L-24,685.9 L-35,176.8 S-09,320.8 S-35,464.6
S-64,797.9 S-94,523.9 S-126,157.9 S-156,709.3 S-245,329.8
C-02,103.9 C-22,318.3 C-47,003.3 C-63,330.5 C-82,265.4
C-101,983.4 C-121,602.9 C-143,071.8 C-163,255.0 C-183,492.5