Summary
Transcript IDgene_000027156
Gene IDTTHERM_00463890
Length655 bp
Sequence
AATCAAAAAAATAAAAAAATAACTCAACCAAATTAACAAATTAAAATAAATGAACAAATTTATTATCGTTCTCGCTGCTATTTTAGCTATTTCTTCTGCCTAAACTTTCCTCTGTGAAGAAAAGGATAGATCTGCCAACAAATTATGCACTGACATTTATGAACCTGTTTGTGCAATCAAGCAATCCAACTTACAAGGTGGCAAACCCCTTAGAACTACTTTCTCTAGTCACTGCAATGCTTGCAAAGACTCAAGTGTCCTTTTCGTTGCTGAGGGTCCTTGTGAAGCCTATCCTGAAAACGGTACTTTCTGCCATCCCAACTCTGTCAACAACAAAATGTGCCCCATGATTTACTCCCCTGTTTGTGGTATCGTCCATAATCTCTTTATGTTATGCCAAGGTGGTCCTTGTGTTCAAACTTTCGGCAATGGTTGCTAAGCTTGCACAGGTGGTTCATTCTTCTACACTCCTGGTAAATGTCTTAGCAAATTCGATTAAGATTAATGATCATCTCTTTAACAAAATAAAATAAAATATATACAATATAATATAATATAATTTAAAGCTGTTTAATCGTATTTTAAATGAAAATATCCATTCATATATTTAATTAGTATTTTATCTTTAAAGCAGTTTTTAAAAATCAAATTGAAA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1377.0 L-22,151.3 L-38,434.4 S-0222.0 S-32,103.4
S-61,148.7 S-91,819.0 S-122,839.5 S-155,831.7 S-243,092.7
C-04,090.3 C-21,673.5 C-42,168.0 C-613,161.9 C-86,642.9
C-103,623.9 C-121,825.0 C-14950.3 C-161,728.4 C-18908.1