Summary
Transcript IDgene_000027168
Gene IDTTHERM_01161020
Length878 bp
Sequence
TTAGAAAATGCTTAGTAGGTGTTGTTTAGATGTGTTCTACTCACAATAAAAAATAAAATATGGAATTTATTCTTTAAAATTTAAAATAAGCTCATGAAAAATAAGCGAAAATATGCTTTTTTCCTGAAGCCTTTGCAATGATTTCTAGAAGTTTTGCAGAAACATTTGAAAACGCAGAATATATTGATGGTGAAATGATAAATTGCTTAAGAGATCATGCTAAAAAGTATAATTTGTGGCTATCGCTTGGAGGCTTTTAGGAAAGATTAAAAGAAAATGATAAAAAGATGGGAAATACTCATATCATTATTGATAATTTAGGAAACATAGTATAAACTTATAAGAAGCTTCATCTTTTTGATATAAGCATCGACACAAAAAACACAATATCTGAAAGTAGTGGTTATGTATTTGGCGACTAAGTTCCAAATGTTGTTGACTCTCCTGCAGGCAGGTTAGGATTATCTATTTGCTATGACTTGAGATTCCCTGAGCTTTTTAGACTTCTCGCAGTTCAACAGAAAGCTGAAATATTATTAGTTCCAAGTGCTTTTTTTAAAAAGACTGGCTAAGCTCACTGGCATACTCTACTAAAAGCTAGAGCCATAGAAAATTAATGCTTCGTTATTGCAGCTGCATAAGCAGGATAGCATAATGATAAAAGAGAAAGCTATGGACACTCTTTAGTTATAGATCCTTGGGGTGAAGTATTATTGGATATGGGACCAGAAAAGCTTGGTATTGATTTTGTAGAAATAGATTTGGAAAAAATTGATACAGTCAGAAAAGGTTTACCAGCTATAAATCATATTAGAAACGATATTTACAAGCTATCTAAAATTTGATAAAAAATATTTATTTGGATTTTTATAAGCAAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,545.0 L-22,755.8 L-33,204.5 S-0889.3 S-3974.5
S-6822.8 S-9684.5 S-12647.5 S-15657.1 S-24493.5
C-0883.8 C-21,698.9 C-4730.5 C-6344.4 C-8388.2
C-101,669.5 C-121,063.9 C-14375.5 C-16314.4 C-18337.8