Summary
Transcript IDgene_000027253
Gene IDTTHERM_00722950
Length888 bp
Sequence
AGTAAAATAAAAATACTCATTAAGTGTAATAAACTTTAGCCAAATCTACAACTTCTTAAATATTCTTGAACTAATTTCTATTAACCATAAGAGATCTAGCAAACTTTATAGCTGCTATTTCGCATTTAGAACGAACATCAAGATCTGATATGGAATCTAAATCTTCTACGTGTGCTATTCCAATGATTCTTCTGATCATCTTTGCAGCAGCAAATCCTAGTGTGTCTTAGAAAATATTTTTTAAGTATTTTATTTAAATTGCTATCTTGATGTTATTATTTTTGTTAATTAAGTTTGGAGGGAAATCACCACCATTTTAAACATTTGATTTGGTATTCCAGATATTTAAGAACTCTTCTTCGTATTAAGTATAGAAACTAACTGTAGTATCTAAAAGCCATTGAGAGTATTCTGAAATTTAATTTACTTCATTTTCATGTTATTTTTAACTAAAGAAATTCAAGAATAGATTAGCAACAAAAGCGCCAGTGTCGAATCCTATTGGACCATAAAAAGCAAATTCAGGGTCAATAACTCTAGTTTCATTCTCTGTGACCATTATACTTCCTGTATGTAGATCACCGTGAATAAGAGCTTCCTTAGATGTTATAAATTTATGACGAAGCTCAGAAATAGCTACTATTAATTCATCATCTGCAATTTTTATAGTTTTAACTATATCGTCTAATTGAGGTGTTGTCCATTTGTTATAGTGAGAGTCTACATAAGGATCTGAGAAGATAACTTATTCTGTCAAAGCACACAATTCTGTATTTTCACTCCAAAAACTAACCTTTTCACGATAAGTTTTGTTATCTAAATGTAATGGGCTACTGTAAAAATGTGTTTTAGCAGAGAACATAGCTATATCTTTTGCTAATTTTGGAT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-12,311.2 L-22,295.1 L-32,489.2 S-0452.4 S-3336.3
S-6159.3 S-9101.5 S-12112.8 S-1574.4 S-2462.3
C-0728.9 C-2264.5 C-4195.5 C-6141.3 C-8211.7
C-10345.5 C-12217.7 C-14424.8 C-16376.9 C-18296.6