Summary
Transcript IDgene_000027402
Gene IDTTHERM_00941580
Length617 bp
Sequence
GTCAAATTTAACACCGTTTTTAAGTTATTCAATAAAAGGTGGAAAACACTTCAAAAAGCCTGTGTATGCAGGAGTGGAAATAAAGTTATTATAAAGAAGAGCATCCTCCATTTTTATTTACTAATATATTCCTCCAGCATTAGTAATCTCATATGAAGTAGGAGTTGGACCTCCCAACACAATTCCTTCAATACAACCCTAAAGAGCACATAGAATTTGATAGCCATGGCATATTACTAAGATGGACTTTTTGCTATCTGTGAAATGTTTAACTAATTTTAAAACGCTAGGGTCGTATTTCAAATATTCAGGAGCCCTTCCACCAGCTAAAACTAAAGCATAATATTCTTCTGGTTTTACTTGATCAAAATCATAATTTAAAAAGAATCTATGGCCTATTTTTTCAGTATAAGTTTAAAACTTTTCTATTTCACCACCTTCTTCTACAACACAAGTAACATAGTCTCCTGCCTTTTTATTAGGGCAAACAGTATGCACAGTATATCCTATAGCATGAAGAACTTAAAAGGGAACCATAACTTCGTAATCCTCTCCAAAGTCTCCTGTAATTAGTAAAATTTTTTGGCTCATTTTTATTATTTATTTATTCTATTGTT
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-15,000.9 L-23,109.6 L-32,801.5 S-0394.6 S-341.3
S-642.6 S-943.8 S-1250.8 S-1531.5 S-2432.8
C-039.0 C-229.2 C-439.3 C-631.7 C-8137.6
C-1052.7 C-1244.3 C-1428.9 C-1628.1 C-1833.7