Summary
Transcript IDgene_000027524
Gene IDTTHERM_00660330
Length1108 bp
Sequence
AATTCAAAAAATTAAAATAAAAGTAATTTAAATAAAAAAGTAAAATCTTAATTAAAAATAAATGGGTGATAACTAGAAGAGACACTTTACCAATAAATATTATGAAAATAAAGAACCTAAGTTCAACTACTTACACAAAAAAGTTAGAGAATACACTGTTGACAACAATGGTAAGGAAGTGCCTGAATAATCTGGATAGAATGAATATAAGGTGACATCCAGATAATCAACAATGATTATTAAGAAAATTGCTTAAGATAGCGAGTAATAAAAAAATCAAAATAACTTCCCCGTCACTTTAAGTGCTATTGGTTATGCTGTTAATCATGCATTTTAAATTTTATAGGCCTACAAATAAACTAACTCTGTTGTTGGTGATGTCAAAATTTAGATGTCAACTCTTATTATGGAGTTTGAAGCAGAACCTCTCGTTGAAGGTTTAGAAAAATTGGATTACAAAACTGTAAACGGTAAGATTACCATTCAATTCACTTTGAATATTTAAAACAATGAAGAAAATGAGAGAAAATTAAACAGTATCCACATCTCTAACAGAGTATCTAGAAATAGAGGATACAACAAGGGCTAAAGAGTATCTAGAAAAAGAAATTATAAAAATAATTAAAAGCCATATAAGCCATAAAGCAAAAAAAGAGGTTTTCGTAGCAATGGCAATGGTAACCAAGAAACAAATCAAGAAAATGGTTATGATTAAAATAAAAATCAACATCAACATCCTCACAATCATTAAAACAAATCAAATTAAGACAATCAGCAATAAAATAAGGGCGAAAGAGGAAATAGAAGAAATGATCGTACTAAAGTCAATTAAGGCAAAAAACCTAATTTTTAACCTAAGTAAAGAGATAACCAAAACAAAAGAAACTAATAATAGTAATAGTAATAATAATAATAATAATAGACTCCTTAGTGATGGAATCAAAGAAGCAGGATGAATAATTTTTTTTAATGATGTCTTTACTTAAAACAATTTGATTATTTAAGATATTTATGTAGAAATAAACCCAAATCTGCTTTTATTTATAAATAAAAACTTTATCTTGTTAGTTAATTAAAATTTAAAATATTTTTAATAAAGTTAATCGCA
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-110,295.2 L-29,138.6 L-39,844.5 S-08,350.0 S-35,404.5
S-65,138.6 S-94,209.0 S-124,446.3 S-154,088.8 S-244,427.5
C-03,770.4 C-22,817.1 C-45,279.2 C-64,877.1 C-85,815.0
C-105,191.4 C-123,993.4 C-145,407.2 C-163,952.7 C-184,228.9