Summary
Transcript IDgene_000027658
Gene IDTTHERM_00346810
Length312 bp
Sequence
CTCTGCTCCAAATAAAAATCTAACATCTCCAATATAAGAAAGAGAAGCAATAGTCATTAAAAACTCTTTCATTTCAATATAGGGTTTAAAGTTTAAGAGCAAGCTGATTGCTGTTGCTTGAATTAAATTGACCCTTAAATCAGAATTTAAAGTAGGATTTTGGACTTAATCAAGCTAAATAATTTTAACAGGTTTGTGAAGTCTCCCGCTGCAAGTGAGAATATTCCATTTTAACAAATCTTTGCTAAGCTATTTAACATCAACAACTCCATATTTAATATTAAGTTTCCTTTTTTAATCAAATGAATCAAC
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-11,432.4 L-21,296.9 L-3830.8 S-0214.1 S-351.8
S-650.1 S-986.1 S-1251.3 S-15124.6 S-24114.4
C-058.7 C-271.2 C-444.0 C-649.8 C-870.6
C-10172.5 C-12155.5 C-1494.1 C-1671.7 C-1890.3