Summary
Transcript IDgene_000027659
Gene IDTTHERM_00346810
Length333 bp
Sequence
CTTGGATTGAAATGAACTGGAGTGATGTATTATTATAAAAAATGTAAATATGATGAACCTAAGTAATAACCCAAACCACTATAGTGTGAAGGGTTTTTTATTAAGTTCATTCTATGCCATTCATCTGCATCTTATACTCCAAATATTAAATCGATCATAGGTGAATCTTTACTATAATCATAACCTATTTATCTAAAAACTCCTGAACCATATCCAAATGCGAAATCTATTTTTGGGAAATCCCTTTAAATTATTGAATCAAGCTAAAGCTCCTCAACTAAACTCTTTTCTTCCTATTTTACTTATGACATTTGTATATTCTTTTAAATAGAG
Expression Profile

NOTE:Microarray expression values were re-normalized using the median value of the normalized expression value for probes located in the corrected gene models.

L-1666.5 L-2654.5 L-3453.0 S-0107.2 S-338.7
S-636.7 S-952.2 S-1259.8 S-1574.1 S-24101.6
C-065.1 C-249.5 C-445.3 C-674.2 C-840.4
C-10106.3 C-1274.6 C-1475.2 C-1649.8 C-1874.7